Previous Contig 008259:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B22Sequence520008259 (9)gb:COTFIB_16483877e-05Gossypium hirsutum ORF with two tentative start codons, complete cds.626008259 (9)gb:COTFIB_16483872e-04Gossypium hirsutum ORF with two tentative start codons, complete cds.
JMFF025H01Sequence479001917 (11)pir|S65063|S650631e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16541008259 (9)
JMFF045B10Sequence619001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16284008259 (9)
JMFF049F20Sequence627001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16533008259 (9)gb:COTFIB_16483871e-05Gossypium hirsutum ORF with two tentative start codons, complete cds.
JMFS100F01Sequence612008259 (9)gb:COTFIB_16483871e-04Gossypium hirsutum ORF with two tentative start codons, complete cds.
JMSF023A06Sequence486001917 (11)pir|S65063|S650632e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16669008259 (9)gb:AY389548_11781930.003Hyacinthus orientalis unknown mRNA.
JMSF046E16Sequence767001917 (11)pir|S65062|S650621e-06fiber protein E6 (clone CKE6-4A) - upland cotton>gb:GHU30506_1680151 Gossypium h543008259 (9)gb:HSU63332_20253713e-15Human super cysteine rich protein mRNA, partial cds.
JMSF046F10Sequence720001917 (11)pir|S65063|S650636e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16620008259 (9)gb:HSU63332_20253713e-26Human super cysteine rich protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003B22+ TATTTTGATTTACCAAACAGGGACTTCGCACCT
                      ____________________________________________________________
consensus TATTTTGATTTACCAAACAGGGACTTCGCACCT
 
. : . : . : . : . : . :
JMFS100F01- CGGCGGC
rJMFF025H01+ GGC
rJMSF023A06+ GGCGGC
rJMSF046E16+ CGGC
rJMSF046F10+ GGC
JMFF003B22- GGCGGC
rJMFF003B22+ GAATCCATGGCTGATGCTACCGAAAACTCCGCCGAATCGAAGCTTAAAGACGCCGGCGGC
                      ____________________________________________________________
consensus GAATCCATGGCTGATGCTACCGAAAACTCCGCCGAATCGAAGCTTAAAGACGCCGGCGGC
 
. : . : . : . : . : . :
rJMFF049F20+ ACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGC
JMFS100F01- AACCGCTACAACTACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGC
rJMFF025H01+ AACCGNTACAANTACAACAACGGNGGNGNTGCAAACAGGTTTGAGCAGCAAGGGATGAGN
rJMSF023A06+ AACCGCTACAACTACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGC
rJMSF046E16+ AACCGCTACAACTACAACAACGGNGGCGCTGCAAACNGGTTTGAGCNGCNAGGGATGAGC
rJMSF046F10+ AACCGNTNCAAATACAACAACGGNGGCGNTGCAAACNGGTTTGAGCNGCNAGGGNTGAGC
JMFF003B22- AACCGCTACAACTACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGC
rJMFF003B22+ AACCGCTACAACTACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGC
                      ____________________________________________________________
consensus AACCGCTACAACTACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGC
 
. : . : . : . : . : . :
rJMFF049F20+ GACACAAGATTCATGGAAAATGGGAGGTATTACTATGATGTCAACACAGAGAAGTACGCC
JMFS100F01- GACACAAGATTCATGGAAAATGGGAGGTATTACTATGATGTCAACACAGAGAAGTACGCC
rJMFF025H01+ GACNCAAGATTCATGGAAAATGGGNGGTNTTTNTNTGATGTCAACCCAGAGAAGTNCNCC
rJMSF023A06+ GACNCNAGATTCATGGAAAATGGGAGGTATTACTATGATGTCAACNCAGAGAAGTACGCC
rJMSF046E16+ GACCCNAGATTCNTGGAAAATGGGNGGTNTTACTATGATGTCNACCCNGNGAAGTACNCC
rJMSF046F10+ GNCCCNAGATTCNTGGAAAATGGGNGGNATTACTNTGATGTCAACNCNGNGAAGTNCGCC
JMFF003B22- GACACAAGATTCATGGAAAATGGGAGGTATTACTATGATGTCAACACAGAGAAGTACGCC
rJMFF003B22+ GACACAAGATTCATGGAAAATGGGAGGTATTACTATGATGTCAACNCAGAGAAGTACGCC
                      ____________________________________________________________
consensus GACACAAGATTCATGGAAAATGGGAGGTATTACTATGATGTCAACACAGAGAAGTACGCC
 
. : . : . : . : . : . :
rJMFF049F20+ AGACATCCATACGAGAATTCAAGAAACCAGTTCAACAACAATGGAGGATTCGACAACAAC
JMFS100F01- AGACATCCATACGAGAATTCAAGAAACCAGTTCAACAACAATGGAGGATTCGACAACAAC
rJMFF025H01+ AGACATCCATNCGNGAATTCAAGAAACCAGTTCAACAACAATGGNGGNTTTGNCAACAAC
rJMSF023A06+ NGACATCCATNCGNGAATTCAAGAAACCAGTTCAACAACAATGGNGGATTNGNCAACAAC
rJMSF046E16+ NGACNTCCNTNCGNGAATTCAAGAAACCNGTTCAACAACNATGGNGGNTTTGGCAACAAC
rJMSF046F10+ NGACNTCCNTNCGNGAATTCAAGAAACCNGTTCAACAACNATGGNGGNTTNGGCAACAAC
JMFF003B22- AGACATCCATACGAGAATTCAAGAAACCAGTTCAACAACAATGGAGGATTCGACAACAAC
rJMFF003B22+ AGACATCCATACGAGAATTCAAGAAACCAGTTCAACAACAATGGAGGATTNGACAACAAC
                      ____________________________________________________________
consensus AGACATCCATACGAGAATTCAAGAAACCAGTTCAACAACAATGGAGGATTCGACAACAAC
 
. : . : . : . : . : . :
rJMFF045B10+ CCAGAATATGGGGGAGTTCCAGGCC
rJMFF049F20+ AACAACAACAACAATGGATTCATGGAGAACAACTACCAGAATATGGAGGAGTTCCAGGAC
JMFS100F01- AACAACAACAACAATGGATTCATGGAGAACAACTACCAGAATATGGAGGAGTTCCAGGAC
rJMFF025H01+ AACAACAACAACAATGGATTCATGGNGAACAACTNCCNGAATNTGGAGGAGTTCCNGGNC
rJMSF023A06+ AACAACAACAACAATGGATTCATGGNGAACAACTACCNGAATATGGNGGAGTTCCNGGAC
rJMSF046E16+ AACAACAACNACNATGGNTTCNTGGNGAACNACTNCCCGAATATGGNGGNGTTCCNGGNC
rJMSF046F10+ AACAACAACNACAATGGNTTCNTGGNGAACNACTACCNGAATATGGNGGNGTTCCNGGNC
JMFF003B22- AACAACAACAACAATGGATTCATGGAGAACAACTACCAGAATATGGAGGAGTTCCAGGAC
rJMFF003B22+ AACAACAACAACAATGGATTCATGGAGAACAACTACCAGAATATGGAGGAGTTCCAGGAC
                      ____________________________________________________________
consensus AACAACAACAACAATGGATTCATGGAGAACAACTACCAGAATATGGAGGAGTTCCAGGAC
 
. : . : . : . : . : . :
rJMFF045B10+ CAAGAAGCCCTTCCCTGAGATTCCTTAACAATTTTTTTTTTTTTTC--CAAAGTTAAAAG
rJMFF049F20+ CAAGAAGACCTTCCCTGAGATTCCTTAACAATTTTTTTTTTTTTTCTACAAAGTTAAAAG
JMFS100F01- CAAGAAGACCTTCCCTGAGATTCCTTAACAA-T-TTTTTTTTTTTCTACAAAGTTAAAAG
rJMFF025H01+ CAAGAAGACCTTCCCTGAGATTCCTTAACAA-TTTTTTTTTTTTTCTACAAAGTTAAAAG
rJMSF023A06+ CAAGAAGACCTTCCCTGAGATTCCTTAACAA-T-TTTTTTTTTTTCTACAAAGTTAAAAG
rJMSF046E16+ CNAGAAGNCCTTCCCTGNGATTCCTTAACAA-TTTTTTTTTTTTTCTACAAAGTTAAAAG
rJMSF046F10+ CNAGAAGNCCTTCCCTGNGATTCCTTAACAA-TTTTTTTTTTTTTCTACAAAGTTAAAAG
JMFF003B22- CAAGAAGACCTTCCCTGAGATTCCTTAACAA-T--TTTTTTTTTTCTACAAAGTTAAAAN
rJMFF003B22+ CAAGAAGACCTTCCCTGAGATTCCTTAACAA-T--TTTTTTTTTTCTACAAAGTTAAAAG
                      ____________________________________________________________
consensus CAAGAAGACCTTCCCTGAGATTCCTTAACAA-TTTTTTTTTTTTTCTACAAAGTTAAAAG
 
. : . : . : . : . : . :
rJMFF045B10+ ATGTTCATGTGGCGGAGTCCCAAAATTTGCAAATTAACCCCCCGCCGGGGGGTTTGATTG
rJMFF049F20+ ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
JMFS100F01- ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
rJMFF025H01+ ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
rJMSF023A06+ ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
rJMSF046E16+ ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
rJMSF046F10+ ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
JMFF003B22- ATGATCATGT
rJMFF003B22+ ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
                      ____________________________________________________________
consensus ATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTG
 
. : . : . : . : . : . :
rJMFF045B10+ GGGGTTAAATTATGGTTGTTTAGGGGGGAATATGTTGATGAGGATTAAGCTATAGATTTG
rJMFF049F20+ TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
JMFS100F01- TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
rJMFF025H01+ TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
rJMSF023A06+ TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
rJMSF046E16+ TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
rJMSF046F10+ TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
rJMFF003B22+ TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
                      ____________________________________________________________
consensus TGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTG
 
. : . : . : . : . : . :
rJMFF045B10+ TTCATAGGTTATTAATTATCCCCGGTCTCTATAGTTATATGGGGGGGGAAGGAGC-CCAT
rJMFF049F20+ TTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGAGA-CCAT
JMFS100F01- TTCATAGGTTATTAATTATCTCCTGTCTCTATAG
rJMFF025H01+ TTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGAGA-CCAT
rJMSF023A06+ TTCATAGGTTATTAATTATCTCCTGTCTCTA
rJMSF046E16+ TTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGAGA-CCAT
rJMSF046F10+ TTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGAGATCCAT
rJMFF003B22+ TTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGAGA-CCAT
                      ____________________________________________________________
consensus TTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGAGA-CCAT
 
. : . : . : . : . : . :
rJMFF045B10+ GAAA-CTATGGTTTTGTGTC
rJMFF049F20+ GAAA-CTATGGTTTTGTGTCAA-CTGGTCTAGACCAAATCTATATATTAAACTCGAC
rJMFF025H01+ GAAA-CTATGGTTTTGTGTCAA-CTGGTCTAGACCAAATCTATATA
rJMSF046E16+ GAAA-CTATGGTTTTGTGTCAATCTGGTCTNGACCAAATCTANATATTAAACTCGAC
rJMSF046F10+ GAAACCTATGGTTTTGTGTCAATCTGGTCTNGACCAAATCTATATATTAAACTCGAC
rJMFF003B22+ GAAA-CTATGGTTTTGTGTCAA-CTGGTCTAGACCAAATCTATATA-TAAACTCGACAGA
                      ____________________________________________________________
consensus GAAA-CTATGGTTTTGTGTCAA-CTGGTCTAGACCAAATCTATATATTAAACTCGACAGA