Previous Contig 008257:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B16Sequence600008257 (4)gb:BT004788_16378221e-37Arabidopsis thaliana At1g08780 gene, complete cds.714008257 (4)gb:BT004788_16378221e-37Arabidopsis thaliana At1g08780 gene, complete cds.
JMSF022F18Sequence698008257 (4)gb:BT004788_16378223e-38Arabidopsis thaliana At1g08780 gene, complete cds.712008257 (4)gb:BT004788_16378223e-38Arabidopsis thaliana At1g08780 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022F18- GGCAACCCTCTCCGACTCTC
                      ____________________________________________________________
consensus GGCAACCCTCTCCGACTCTC
 
. : . : . : . : . : . :
JMSF022F18- ATCAGTCTTGTTCGAATCACATCTTTCTTCTGGTTTCCACAAAACCTACGAAGACGATCT
JMFF003B16- AGTCTTGTTCGAATCACATCTTTCTTCTGGTTTCCACAAAACCTACGAAGACGATCT
rJMSF022F18+ AGTCTTGTTCGAATCACATCTTTCTTCTGGTTTCCACAAAACCTACGAAGACGATCT
                      ____________________________________________________________
consensus ATCAGTCTTGTTCGAATCACATCTTTCTTCTGGTTTCCACAAAACCTACGAAGACGATCT
 
. : . : . : . : . : . :
JMSF022F18- TACCATCTTCAATCGGTCCAAGTTAAACATGCAGCAGGTCGGAGCTTCGAGTTCGGAAGT
JMFF003B16- TACCATCTTCAATCGGTCCAAGTTAAACATGCAGCAGGTCGGAGCTTCGAGTTCGGAAGT
rJMSF022F18+ TACCATCTTCAATCGGTCCAAGTTAAACATGCAGCAGGTCGGAGCTTCGAGTTCGGAAGT
rJMFF003B16+ CTTCAATCGGTCCAAGTTAAACATGCAGCAGGTCGGAGCTTCGAGTTCGGAAGT
                      ____________________________________________________________
consensus TACCATCTTCAATCGGTCCAAGTTAAACATGCAGCAGGTCGGAGCTTCGAGTTCGGAAGT
 
. : . : . : . : . : . :
JMSF022F18- GGAAGTGACCTGGGAGGATCAACAGAAAATCAACAAATTCAGCCGACTTAACACTCGCTT
JMFF003B16- GGAAGTGACCTGGGAGGATCAACAGAAAATCAACAAATTCAGCCGACTTAACACTCGCTT
rJMSF022F18+ GGAAGTGACCTGGGAGGATCAACAGAAAATCAACAAATTCAGCCGACTTAACACTCGCTT
rJMFF003B16+ GGAAGTGACCTGGGAGGATCAACAGAAAATCAACAAATTCAGCCGACTTAACACTCGCTT
                      ____________________________________________________________
consensus GGAAGTGACCTGGGAGGATCAACAGAAAATCAACAAATTCAGCCGACTTAACACTCGCTT
 
. : . : . : . : . : . :
JMSF022F18- CCATGAACTCGAAGATGAAATCAAGGTCGCTAAGGAAACATGTGAAAATATGGAAGATGC
JMFF003B16- CCATGAACTCGAAGATGAAATCAAGGTCGCTAAGGAAACATGTGAAAATATGGAAGATGC
rJMSF022F18+ CCATGAACTCGAAGATGAAATCAAGGTCGCTAAGGAAACATGTGAAAATATGGAAGATGC
rJMFF003B16+ CCATGAACTCGAAGATGAAATCAAGGTCGCTAAGGAAACATGTGAAAATATGGAAGATGC
                      ____________________________________________________________
consensus CCATGAACTCGAAGATGAAATCAAGGTCGCTAAGGAAACATGTGAAAATATGGAAGATGC
 
. : . : . : . : . : . :
JMSF022F18- AAGCAACGAGTTAATTCTCACGGACGAGGAGGTAGTGCGGTTCCAGATAGGAGAGGTTTT
JMFF003B16- AAGCAACGAGTTAATTCTCACGGACGAGGAGGTAGTGCGGTTCCAGATAGCAGAGGTTTT
rJMSF022F18+ AAGCAACGAGTTAATTCTCACGGACGAGGAGGTAGTGCGGTTCCAGATAGGAGAGGTTTT
rJMFF003B16+ AAGCAACGAGTTAATTCTCACGGACGAGGAGGTAGTGCGGTTCCAGATAGCAGAGGTTTT
                      ____________________________________________________________
consensus AAGCAACGAGTTAATTCTCACGGACGAGGAGGTAGTGCGGTTCCAGATAGGAGAGGTTTT
 
. : . : . : . : . : . :
JMSF022F18- TGCACATGTGGCAAAGGAAGAAGTGGAGAGCAGGATAGAGGAAATGAAAGAGGTTACTAG
JMFF003B16- TGCACATGTGGCAAAGGAAGAAGTGGAGAGCAGGATAGAGGAAATGAAAGAGGTTACTAG
rJMSF022F18+ TGCACATGTGGCAAAGGAAGAAGTGGAGAGCAGGATAGAGGAAATGAAAGAGGTTACTAG
rJMFF003B16+ TGCACATGTGGCAAAGGAAGAAGTGGAGAGCAGGATAGAGGAAATGAAAGAGGTTACTAG
                      ____________________________________________________________
consensus TGCACATGTGGCAAAGGAAGAAGTGGAGAGCAGGATAGAGGAAATGAAAGAGGTTACTAG
 
. : . : . : . : . : . :
JMSF022F18- CAAGAAGCTGGAGAAACTAGAGGAAGAGAAGGAAAGCGTGGTTGCCCAGATGGCGGAGCT
JMFF003B16- CAAGAAGCTGGAGAAACTAGAGGAAGAGAAGGAAAGCGTGGTTGCCCAGATGGCGGAGCT
rJMSF022F18+ CAAGAAGCTGGAGAAACTAGAGGAAGAGAAGGAAAGCGTGGTTGCCCAGATGGCGGAGCT
rJMFF003B16+ CAAGAAGCTGGAGAAACTAGAGGAAGAGAAGGAAAGCGTGGTTGCCCAGATGGCGGAGCT
                      ____________________________________________________________
consensus CAAGAAGCTGGAGAAACTAGAGGAAGAGAAGGAAAGCGTGGTTGCCCAGATGGCGGAGCT
 
. : . : . : . : . : . :
JMSF022F18- GAAAAAGGCGTTGTATGCAAAATTCAAAGACTCCATCAATCTGGAGGAGGATTAACAAAA
JMFF003B16- GAAAAAGGCGTTGTATGCAAAATTCAAAGACTCCATCAATCTGGAGGAGGATTAACAAAA
rJMSF022F18+ GAAAAAGGCGTTGTATGCAAAATTCAAAGACTCCATCAATCTGGAGGAGGATTAACAAAA
rJMFF003B16+ GAAAAAGGCGTTGTATGCAAAATTCAAAGACTCCATCAATCTGGAGGAGGATTAACAAAA
                      ____________________________________________________________
consensus GAAAAAGGCGTTGTATGCAAAATTCAAAGACTCCATCAATCTGGAGGAGGATTAACAAAA
 
. : . : . : . : . : . :
JMSF022F18- TGCCATACTCATACAGCCATAGTATGGTAATTTTGCCATCCATCCAAATATGCTATGGAA
JMFF003B16- TGCCATACTCATACAGCCATAGTATGGTAATTTTGCCATCCATCCAAATATGCTATGGAA
rJMSF022F18+ TGCCATACTCATACAGCCATAGTATGGTAATTTTGCCATCCATCCAAATATGCTATGGAA
rJMFF003B16+ TGCCATACTCATACAGCCATAGTATGGTAATTTTGCCATCCATCCAAATATGCTATGGAA
                      ____________________________________________________________
consensus TGCCATACTCATACAGCCATAGTATGGTAATTTTGCCATCCATCCAAATATGCTATGGAA
 
. : . : . : . : . : . :
JMSF022F18- TTGTAGCCTAAATACCATTAGTATCTTGCTGTGCTTGCCCTGGATTTGTTTTATTGAGTA
JMFF003B16- TTGTAGCCTAAATACCATTAGTATCTTGCTGTGCTTGCCCTGGATTTGTTTTATTGAGTA
rJMSF022F18+ TTGTAGCCTAAATACCATTAGTATCTTGCTGTGCTTGCCCTGGATTTGTTTTATTGAGTA
rJMFF003B16+ TTGTAGCCTAAATACCATTAGTATCTTGCTGTGCTTGCCCTGGATTTGTTTTATTGAGTA
                      ____________________________________________________________
consensus TTGTAGCCTAAATACCATTAGTATCTTGCTGTGCTTGCCCTGGATTTGTTTTATTGAGTA
 
. : . : . : . : . : . :
JMSF022F18- GGATTGTTCACGTGTGAAATTGAATTTTCAGTTCATTTAATTTTTGATTAGTTTATTGGT
JMFF003B16- GG
rJMSF022F18+ GGATTGTTCACGTGTGAAATTGAATTTTCAGTTCATTTAATTTTTGATTAGTTTATTGGT
rJMFF003B16+ GGATTGTTCACGTGTGAAATTGAATTTTCAGTTCATTTAATTTTTGATTAGTTTATTGGT
                      ____________________________________________________________
consensus GGATTGTTCACGTGTGAAATTGAATTTTCAGTTCATTTAATTTTTGATTAGTTTATTGGT
 
. : . : . : . : . : . :
JMSF022F18- GACAACAATTGGTACTAC
rJMSF022F18+ GACAACAATTGGTACTACAACAACCAAGACTTTCAAGTTTAAACATGTT
rJMFF003B16+ GACAACAATTGGTACTACAACAACCAAGACTTTCAAGTTTAAACATGTTTTTAGGATGCA
                      ____________________________________________________________
consensus GACAACAATTGGTACTACAACAACCAAGACTTTCAAGTTTAAACATGTTTTTAGGATGCA
 
. : . : . : . : . : . :
rJMFF003B16+ GTTCAGCTTATTCGCATGTTGAATCTTTTAAGTGGGATCCATTTCTTATATTAATATAAT
                      ____________________________________________________________
consensus GTTCAGCTTATTCGCATGTTGAATCTTTTAAGTGGGATCCATTTCTTATATTAATATAAT