Previous Contig 008249:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O24Sequence516000118 (2)pir|C84920|C849202e-25hypothetical protein At2g47850 [imported] - Arabidopsis thaliana>gb:AC005309_153148008249 (2)
JMSF019D15Sequence478000118 (2)pir|C84920|C849202e-26hypothetical protein At2g47850 [imported] - Arabidopsis thaliana>gb:AC005309_153729008249 (2)pir|C84920|C849201e-40hypothetical protein At2g47850 [imported] - Arabidopsis thaliana>gb:AC005309_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019D15+ TTCT
                      ____________________________________________________________
consensus TTCT
 
. : . : . : . : . : . :
rJMSF019D15+ ACACCTACTTTTGCTGGACCATACTCCCCTTTACACACTACTACTGGTCTTTCTAGCTGT
                      ____________________________________________________________
consensus ACACCTACTTTTGCTGGACCATACTCCCCTTTACACACTACTACTGGTCTTTCTAGCTGT
 
. : . : . : . : . : . :
rJMSF019D15+ GCACAACGCGAGAAAGGTTTTTTCCCTGAAAGACCAGGGCAACCAGAATGTGAATACTAC
                      ____________________________________________________________
consensus GCACAACGCGAGAAAGGTTTTTTCCCTGAAAGACCAGGGCAACCAGAATGTGAATACTAC
 
. : . : . : . : . : . :
rJMSF019D15+ AAGAAAACTGGGAATTGCAAATTTGGATCTTCTTGTAAGTTTCACCATCCACCAGATTGG
                      ____________________________________________________________
consensus AAGAAAACTGGGAATTGCAAATTTGGATCTTCTTGTAAGTTTCACCATCCACCAGATTGG
 
. : . : . : . : . : . :
rJMSF019D15+ GTTCCACCTAACTCAAATTGCTCTTTCAGTCCACTGGGGCTTCCTCTGCGTCCGGGAGTG
                      ____________________________________________________________
consensus GTTCCACCTAACTCAAATTGCTCTTTCAGTCCACTGGGGCTTCCTCTGCGTCCGGGAGTG
 
. : . : . : . : . : . :
rJMSF019D15+ CAAGCTTGTTGTTTTTATTTGCGCAAGGGATTCTGCAAGTTTGGTGGAAATTGCAAATTT
                      ____________________________________________________________
consensus CAAGCTTGTTGTTTTTATTTGCGCAAGGGATTCTGCAAGTTTGGTGGAAATTGCAAATTT
 
. : . : . : . : . : . :
rJMSF019D15+ GATCACCCAATGGAGACGGTTCATTATAGTCCATCAGTTTCTTCTTCTTCTCTTACCGAT
                      ____________________________________________________________
consensus GATCACCCAATGGAGACGGTTCATTATAGTCCATCAGTTTCTTCTTCTTCTCTTACCGAT
 
. : . : . : . : . : . :
rJMSF019D15+ GCTCCTCCCTACATGGTGCAGCCTGGATTTGCTGATACCTCCTTCTCTAGATCTAGATTA
                      ____________________________________________________________
consensus GCTCCTCCCTACATGGTGCAGCCTGGATTTGCTGATACCTCCTTCTCTAGATCTAGATTA
 
. : . : . : . : . : . :
rJMSF019D15+ GCATTACCATTACCTTCAGTTGGTTTTAAGCTTTCTCACACAGCTCCTTCTCCTACTTCA
                      ____________________________________________________________
consensus GCATTACCATTACCTTCAGTTGGTTTTAAGCTTTCTCACACAGCTCCTTCTCCTACTTCA
 
. : . : . : . : . : . :
rJMSF019D15+ CGTTCCAACATGCGGTCACATTGCTGAAGCTCGCCCAGCTTCATCTCAAAACACTTTAGC
                      ____________________________________________________________
consensus CGTTCCAACATGCGGTCACATTGCTGAAGCTCGCCCAGCTTCATCTCAAAACACTTTAGC
 
. : . : . : . : . : . :
rJMSF019D15+ ACAGTTTACACTTGCAATGCTGCCTGCTATTTAGTATTTAGGCGAGAAGGAAGATAAATA
                      ____________________________________________________________
consensus ACAGTTTACACTTGCAATGCTGCCTGCTATTTAGTATTTAGGCGAGAAGGAAGATAAATA
 
. : . : . : . : . : . :
rJMSF019D15+ TGGTTGAGTTAAAGCTCTTCTGCTTCCTTGCTTCTTCTTCCCCCAAGTTTTATACTCTTT
rJMFF002O24+ TCTTCTTCCCCCAAGTTTTATACTCTTT
                      ____________________________________________________________
consensus TGGTTGAGTTAAAGCTCTTCTGCTTCCTTGCTTCTTCTTCCCCCAAGTTTTATACTCTTT
 
. : . : . : . : . : . :
rJMSF019D15+ TGTTGACAAAATGTGACAGGATGGAT-CTGAGGTTGGAAATGTTGTTTTAT-TGATGACA
rJMFF002O24+ NGTTGACAAAATGTGACAGGANGGATCCTGAGGTNGGAAATGTTGTTTTATCNGATGACA
                      ____________________________________________________________
consensus TGTTGACAAAATGTGACAGGATGGATCCTGAGGTTGGAAATGTTGTTTTATCTGATGACA
 
. : . : . : . : . : . :
rJMSF019D15+ GACAGAC
rJMFF002O24+ GACAGACAGATAGACAGAGTCTTACATTACATTACATCACATCATTGTTANGCAATTTAT
                      ____________________________________________________________
consensus GACAGACAGATAGACAGAGTCTTACATTACATTACATCACATCATTGTTANGCAATTTAT