Previous Contig 008239:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002L10Sequence559001130 (4)gb:BT004209_16373053e-84Arabidopsis thaliana clone RAFL15-45-M15 (R50157) putative strictosidine synthas228008239 (2)gb:BT004209_16373056e-20Arabidopsis thaliana clone RAFL15-45-M15 (R50157) putative strictosidine synthas
JMFF022G05Sequence486001130 (4)gb:BT004209_16373055e-73Arabidopsis thaliana clone RAFL15-45-M15 (R50157) putative strictosidine synthas204008239 (2)gb:BT004209_16373058e-17Arabidopsis thaliana clone RAFL15-45-M15 (R50157) putative strictosidine synthas

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022G05+ TCGAGAAAGGGCAATATTGGGTGGCAATAGACTGCTGCA
rJMFF002L10+ TTAGAGNNNTCGAGAAAGGGCAATATTGGGTGGCAATAGACTGCTGCA
                      ____________________________________________________________
consensus TTAGAGNNNTCGAGAAAGGGCAATATTGGGTGGCAATAGACTGCTGCA
 
. : . : . : . : . : . :
rJMFF022G05+ GAACTAGAATCCAGCAGGTTNTGATCANCCATCCATGGACCAGAAGTGTGTACTTCAGNC
rJMFF002L10+ GAACTAGAATCCAGGAGGTTNTGATCAACCATCCATGGACCAGAAGTGTGTNCTTCAGNC
                      ____________________________________________________________
consensus GAACTAGAATCCAGGAGGTTNTGATCAACCATCCATGGACCAGAAGTGTGTACTTCAGNC
 
. : . : . : . : . : . :
rJMFF022G05+ NNCCNCTTCNTATGCAGTATNTGGCAAGATTTGCAGGGATGAAAATGTATACTGTCATCT
rJMFF002L10+ NNCCCCTTCCTATGCAGTATNTGGCAAGATTTGCAGGGATGAAAATGTATACTGTCATCT
                      ____________________________________________________________
consensus NNCCCCTTCCTATGCAGTATNTGGCAAGATTTGCAGGGATGAAAATGTATACTGTCATCT
 
. : . : . : . : . : . :
rJMFF022G05+ CTCTCTTCGATCAAAATGGGGAAGTTCTTGATGTT
rJMFF002L10+ CNCTCTTCGATCAAAATGGGGAAGTTCNTGATGTTNAAGAGGATAAACATGGAGATGTGA
                      ____________________________________________________________
consensus CTCTCTTCGATCAAAATGGGGAAGTTCTTGATGTTNAAGAGGATAAACATGGAGATGTGA