Previous Contig 008231:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002J16Sequence474000036 (10)689008231 (4)pir|T45588|T455888e-53arm repeat containing protein homolog - Arabidopsis thaliana>gb:ATF12A12_1548292
JMFF024L16Sequence456000036 (10)pir|T45588|T455881e-10arm repeat containing protein homolog - Arabidopsis thaliana>gb:ATF12A12_1548292677008231 (4)pir|T45588|T455888e-53arm repeat containing protein homolog - Arabidopsis thaliana>gb:ATF12A12_1548292
JMFF036E12Sequence557000036 (10)pir|T45588|T455882e-05arm repeat containing protein homolog - Arabidopsis thaliana>gb:ATF12A12_1548292661008231 (4)pir|T45588|T455883e-50arm repeat containing protein homolog - Arabidopsis thaliana>gb:ATF12A12_1548292
JMFS068A01Sequence613008231 (4)pir|T45588|T455883e-79arm repeat containing protein homolog - Arabidopsis thaliana>gb:ATF12A12_1548292

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS068A01- TTACAGCGCTACTTAACCTCTCGATATGCGAGGACAATAAAGGAGCCA
                      ____________________________________________________________
consensus TTACAGCGCTACTTAACCTCTCGATATGCGAGGACAATAAAGGAGCCA
 
. : . : . : . : . : . :
JMFS068A01- TCATAGCTTCTGGGGCAGTGCCCGGGATTGTCCATGTGCTCAAGAAGGGAGGCATGGAAG
                      ____________________________________________________________
consensus TCATAGCTTCTGGGGCAGTGCCCGGGATTGTCCATGTGCTCAAGAAGGGAGGCATGGAAG
 
. : . : . : . : . : . :
JMFS068A01- CTCGGGAAAACGCAGCTGCCACTCTTTTTAGCCTCTCGGTTGTGGACGAAAACAAGATCA
                      ____________________________________________________________
consensus CTCGGGAAAACGCAGCTGCCACTCTTTTTAGCCTCTCGGTTGTGGACGAAAACAAGATCA
 
. : . : . : . : . : . :
JMFS068A01- TAATCGGGGGTTCTGGGGCAATCTCTCCCCTCGTAACGCTCCTAAACGAGGGTAGCCAAC
rJMFF024L16+ CGTAACGCTCCTAAACGAGGGTAGCCAAC
rJMFF036E12+ GGGTAGCCAAC
rJMFF002J16+ CGTAACGCTCCTAAACGAGGGTAGCCAAC
                      ____________________________________________________________
consensus TAATCGGGGGTTCTGGGGCAATCTCTCCCCTCGTAACGCTCCTAAACGAGGGTAGCCAAC
 
. : . : . : . : . : . :
JMFS068A01- GAGGAAAGAAAGACGCTGCAACTGCACTCTTCAACCTCTGCATATATCAAGGCAACAAGG
rJMFF024L16+ GAGGAAAGAAAGACGCTGCAACTGCACTCTTCAACCTCTGCATATATCAAGGCAACAAGG
rJMFF036E12+ GAGGAAAGAAAGACGCTGCAACTGCACTCTTCAACCTCTGCATATATCAAGGCAACAAGG
rJMFF002J16+ GAGGAAAGAAAGACGCTGCAACTGCACTCTTCAACCTCTGCATATATCAAGGCAACAAGG
                      ____________________________________________________________
consensus GAGGAAAGAAAGACGCTGCAACTGCACTCTTCAACCTCTGCATATATCAAGGCAACAAGG
 
. : . : . : . : . : . :
JMFS068A01- GCAAGGCAGTAAGGGCGGGGGTCGTGCCAACGCTAATGCAGCTGTTAACCGAGCCACAAG
rJMFF024L16+ GCAAGGCAGTAAGGGCGGGGGTCGTGCCAACGCTAATGCAGCTGTTAACCGAGCCACAAG
rJMFF036E12+ GCAAGGCAGTAAGGGCGGGGGTCGTGCCAACGCTAATGCAGCTGTTAACCGAGCCACAAG
rJMFF002J16+ GCAAGGCAGTAAGGGCGGGGGTCGTGCCAACGCTAATGCAGCTGTTAACCGAGCCACAAG
                      ____________________________________________________________
consensus GCAAGGCAGTAAGGGCGGGGGTCGTGCCAACGCTAATGCAGCTGTTAACCGAGCCACAAG
 
. : . : . : . : . : . :
JMFS068A01- GCAACATGGTGGACGAGGCATTAGCAATACTGGCAATATTGGCTAGTCATCCTGAAGGGA
rJMFF024L16+ GCAACATGGTGGACGAGGCATTAGCAATACTGGCAATATTGGCTAGTCATCCTGAAGGGA
rJMFF036E12+ GCAACATGGTGGACGAGGCATTAGCAATACTGGCAATATTGGCTAGTCATCCTGAAGGGA
rJMFF002J16+ GCAACATGGTGGACGAGGCATTAGCAATACTGGCAATATTGGCTAGTCATCCTGAAGGGA
                      ____________________________________________________________
consensus GCAACATGGTGGACGAGGCATTAGCAATACTGGCAATATTGGCTAGTCATCCTGAAGGGA
 
. : . : . : . : . : . :
JMFS068A01- AGGTAGCCATTGGAGGCGCAAAAGCTGTGGCAGTTCTGGTGGGCGTCATAGCCAACGGGT
rJMFF024L16+ AGGTAGCCATTGGAGGCGCAAAAGCTGTGGCAGTTCTGGTGGGCGTCATAGCCAACGGGT
rJMFF036E12+ AGGTAGCCATTGGAGGCGCAAAAGCTGTGGCAGTTCTGGTGGGCGTCATAGCCAACGGGT
rJMFF002J16+ AGGTAGCCATTGGAGGCGCAAAAGCTGTGGCAGTTCTGGTGGGCGTCATAGCCAACGGGT
                      ____________________________________________________________
consensus AGGTAGCCATTGGAGGCGCAAAAGCTGTGGCAGTTCTGGTGGGCGTCATAGCCAACGGGT
 
. : . : . : . : . : . :
JMFS068A01- CCCCAAGGAACAAAGAAAACGCAGCTGCAGTTCTGGTTCACCTCTGCTCCGGAGAACAAC
rJMFF024L16+ CCCCAAGGAACAAAGAAAACGCAGCTGCAGTTCTGGTTCACCTCTGCTCCGGAGAACAAC
rJMFF036E12+ CCCCAAGGAACAAAGAAAACGCAGCTGCAGTTCTGGTTCACCTCTGCTCCGGAGAACAAC
rJMFF002J16+ CCCCAAGGAACAAAGAAAACGCAGCTGCAGTTCTGGTTCACCTCTGCTCCGGAGAACAAC
                      ____________________________________________________________
consensus CCCCAAGGAACAAAGAAAACGCAGCTGCAGTTCTGGTTCACCTCTGCTCCGGAGAACAAC
 
. : . : . : . : . : . :
JMFS068A01- ACGTAGTAGAAGCTCAAGAACTAGGAATAATGGGACCTCTGCTTGATTTAGCCCAGAACG
rJMFF024L16+ ACGTAGTAGAAGCTCAAGAACTAGGAATAATGGGACCTCTGCTTGATTTAGCCCAGAACG
rJMFF036E12+ ACGTAGTAGAAGCTCAAGAACTAGGAATAATGGGACCTCTGCTTGATTTAGCCCAGAACG
rJMFF002J16+ ACGTAGTAGAAGCTCAAGAACTAGGAATAATGGGACCTCTGCTTGATTTAGCCCAGAACG
                      ____________________________________________________________
consensus ACGTAGTAGAAGCTCAAGAACTAGGAATAATGGGACCTCTGCTTGATTTAGCCCAGAACG
 
. : . : . : . : . : . :
JMFS068A01- GCACCGAAAGAGGACGCCGAA
rJMFF024L16+ GCACCGAAAGAGGACGCCGAAAAGCCGCCCAGTTACTAGAGAAGATAAACAGATTTGCTG
rJMFF036E12+ GCACCGAAAGAGGACGCCGAAAAGCCGCCCAGTTACTAGAGAAGATAAACAGATTTGCTG
rJMFF002J16+ GCACCGAAAGAGGACGCCGAAAAGCCGCCCAGTTACTAGAGAAGATAAACAGATTTGCTG
                      ____________________________________________________________
consensus GCACCGAAAGAGGACGCCGAAAAGCCGCCCAGTTACTAGAGAAGATAAACAGATTTGCTG
 
. : . : . : . : . : . :
rJMFF024L16+ AGCAGCAAACCCAGGCCCAGACAGAGACTCCTGCTCAAACTGAGAACCAGTTGCAGTCAC
rJMFF036E12+ AGCAGCAAACCCAGGCCCAGACAGAGACTCCTGCTCAAACTGAGAACCAGTTGCAGTCAC
rJMFF002J16+ AGCAGCAAACCCAGGCCCAGACAGAGACTCCTGCTCAAACTGAGAACCAGTTGCAGTCAC
                      ____________________________________________________________
consensus AGCAGCAAACCCAGGCCCAGACAGAGACTCCTGCTCAAACTGAGAACCAGTTGCAGTCAC
 
. : . : . : . : . : . :
rJMFF024L16+ CGGCCACCGTGGACGGTTGAGATGGATCTTTTGTTGTTTCTGTATTCTAGAGGATGGAGG
rJMFF036E12+ CGGCCACCGTGGACGGTTGAGATGGATCTTTTGTTGTTTCTGTATTCTAGAGGATGGAGG
rJMFF002J16+ CGGCCACCGTGGACGGTTGAGATGGATCTTTTGTTGTTTCTGTATTCTAGAGGATGGAGG
                      ____________________________________________________________
consensus CGGCCACCGTGGACGGTTGAGATGGATCTTTTGTTGTTTCTGTATTCTAGAGGATGGAGG
 
. : . : . : . : . : . :
rJMFF024L16+ TGGAAGATCACCTCATCTTCTACATTTACCCATATTTTTTTAATCCTGTGTTGAAGGTGT
rJMFF036E12+ TGGAAGATCACCTCATCTTCTACATTTACCCATATTTTTTTAATCCTGTGTTGAAGGTGT
rJMFF002J16+ TGGAAGATCACCTCATCTTCTACATTTACCCATATTTTTTTAATCCTGTGTTGAAGGTGT
                      ____________________________________________________________
consensus TGGAAGATCACCTCATCTTCTACATTTACCCATATTTTTTTAATCCTGTGTTGAAGGTGT
 
. : . : . : . : . : . :
rJMFF024L16+ ATACATCCATGAAAGAGTTATTTCCAATTGGGGAACCAATTCCAC
rJMFF036E12+ ATACATCCATGAAAGAGTTATTTCCAATTGGGGAACCAATTCCAC
rJMFF002J16+ ATACATCCATGAAAGAGTTATTTCCAATTGGGGAACCAATTCCACGTTTGGTTCCTTTCT
                      ____________________________________________________________
consensus ATACATCCATGAAAGAGTTATTTCCAATTGGGGAACCAATTCCACGTTTGGTTCCTTTCT