Previous Contig 008228:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001K04Sequence536000034 (7)gb:CAN246013_16450664e-14Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun756008228 (7)gb:CAN246013_16450663e-86Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun
JMFF002I19Sequence619000034 (7)gb:CAN246013_16450666e-38Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun785008228 (7)gb:CAN246013_16450663e-75Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun
JMFF006F13Sequence524000034 (7)gb:CAN246013_16450662e-45Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun742008228 (7)gb:CAN246013_16450665e-65Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun
JMFS087A02Sequence488008228 (7)gb:CAN246013_16450665e-74Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun
JMSF008A10Sequence232000034 (7)789008228 (7)gb:CAN246013_16450661e-80Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun
JMSF012P20Sequence273000034 (7)756008228 (7)gb:CAN246013_16450669e-91Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun
JMSF026B02Sequence653000034 (7)gb:CAN246013_16450664e-42Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun784008228 (7)gb:CAN246013_16450663e-79Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subun

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS087A02- CCACAGTTGAGAAGGCATCTGTGCACAAAAAGGGTGG
                      ____________________________________________________________
consensus CCACAGTTGAGAAGGCATCTGTGCACAAAAAGGGTGG
 
. : . : . : . : . : . :
JMFS087A02- TGCAAAGAAGGTTGTCATCTCAGCTCCATCTGCTGATGCACCTATGTTTGTGGTGGGTGT
                      ____________________________________________________________
consensus TGCAAAGAAGGTTGTCATCTCAGCTCCATCTGCTGATGCACCTATGTTTGTGGTGGGTGT
 
. : . : . : . : . : . :
JMFS087A02- TAATGAGAACACATACAAAACAACCATGGATGTCGTTTCCAATGCCAGTTGTACCACCAA
rJMSF012P20+ AATGCCAGTTGTACCACCAA
                      ____________________________________________________________
consensus TAATGAGAACACATACAAAACAACCATGGATGTCGTTTCCAATGCCAGTTGTACCACCAA
 
. : . : . : . : . : . :
JMFS087A02- TTGCCTTGCTCCTTTGGCCAAGGTGGTTCACGAGGAGTTTGGCATTGTAGAGGGTTTAAT
rJMSF012P20+ TTGCCTTGCTCCTTTGGCCAAGGTGGTTCACGAGGAGTTTGGCATTGTAGAGGGTTTAAT
rJMFF001K04+ TGCCTTGCTCCTTTGGCCAAGGTGGTTCACGAGGAGTTTGGCATTGTAGAGGGTTTAAT
rJMSF026B02+ CGAGGAGTTNGGCATTGTAGAGGGTTTAAT
rJMSF008A10+ GTTCACGAGGAGTTNGGCATTGTAGAGGGTTTAAT
rJMFF002I19+ TTTAAT
                      ____________________________________________________________
consensus TTGCCTTGCTCCTTTGGCCAAGGTGGTTCACGAGGAGTTTGGCATTGTAGAGGGTTTAAT
 
. : . : . : . : . : . :
JMFS087A02- GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
rJMSF012P20+ GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
rJMFF001K04+ GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
rJMSF026B02+ GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
rJMSF008A10+ GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
rJMFF006F13+ CAGTTGATGGCCNTTCCATGAAGGA
rJMFF002I19+ GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
                      ____________________________________________________________
consensus GACAACTGTGCACGCTACCACAGCCACACAAAAGACAGTTGATGGCCCTTCCATGAAGGA
 
. : . : . : . : . : . :
JMFS087A02- -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGTGCTGCAA
rJMSF012P20+ -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
rJMFF001K04+ -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
rJMSF026B02+ -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
rJMSF008A10+ -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
rJMFF006F13+ TTTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
rJMFF002I19+ -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
                      ____________________________________________________________
consensus -TTGGCGGGGAGGCCGTGGAGCTGGGCAAAACATAATCCCCAGCTCAACTGGGGCTGCAA
 
. : . : . : . : . : . :
JMFS087A02- AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
rJMSF012P20+ AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
rJMFF001K04+ AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
rJMSF026B02+ AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
rJMSF008A10+ AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
rJMFF006F13+ AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
rJMFF002I19+ AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
                      ____________________________________________________________
consensus AGGCTGTTGGAAAAGTTCTTCCAGCACTTAATGGTAAGCTCACTGGAATGGCCTTCCGTG
 
. : . : . : . : . : . :
JMFS087A02- TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
rJMSF012P20+ TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
rJMFF001K04+ TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
rJMSF026B02+ TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
rJMSF008A10+ TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
rJMFF006F13+ TTCCCACACCTAATGTCTCTGT--TAGACCTAACTTGTCGGCTGGAGGAGAGTGCTTCTT
rJMFF002I19+ TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
                      ____________________________________________________________
consensus TTCCCACACCTAATGTCTCTGTTGTAGACCTAACTTGTCGGCTGGAGAAGAGTGCTTCTT
 
. : . : . : . : . : . :
JMFS087A02- ATGAGGATGTCAAAGCAGTCATAAAGTATGCA
rJMSF012P20+ ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
rJMFF001K04+ ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
rJMSF026B02+ ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
rJMSF008A10+ ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
rJMFF006F13+ ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
rJMFF002I19+ ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
                      ____________________________________________________________
consensus ATGAGGATGTCAAAGCAGTCATAAAGTATGCATCGGAAGGTCCACTGAAGGGCATTCTTG
 
. : . : . : . : . : . :
rJMSF012P20+ GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
rJMFF001K04+ GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
rJMSF026B02+ GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
rJMSF008A10+ GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
rJMFF006F13+ GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
rJMFF002I19+ GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
                      ____________________________________________________________
consensus GATACACAGATGAAGATGTTGTATCAAATGATTTTGTTGGTGATTCCAGGTCAAGCATTT
 
. : . : . : . : . : . :
rJMSF012P20+ TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
rJMFF001K04+ TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
rJMSF026B02+ TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
rJMSF008A10+ TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
rJMFF006F13+ TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
rJMFF002I19+ TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
                      ____________________________________________________________
consensus TTGATGCCAAGGCTGGTATAGGTTTGAACGACTCTCTCATGAAGCTTGTGTCCTGGTATG
 
. : . : . : . : . : . :
rJMSF012P20+ ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
rJMFF001K04+ ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
rJMSF026B02+ ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
rJMSF008A10+ ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
rJMFF006F13+ ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
rJMFF002I19+ ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
                      ____________________________________________________________
consensus ATAACGAGTGGGGTTACAGCAATCGGGTGTTGGATTTGATAGAGCACATGGCATTGGTTG
 
. : . : . : . : . : . :
rJMSF012P20+ CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
rJMFF001K04+ CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
rJMSF026B02+ CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
rJMSF008A10+ CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
rJMFF006F13+ CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
rJMFF002I19+ CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
                      ____________________________________________________________
consensus CTGCTGCTACCACCAACTGAATACCAGAGATGGCCAAGGTTGCAAGCAACATTAGCTAGC
 
. : . : . : . : . : . :
rJMSF012P20+ TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTCAGATTTGTTGTGGGAGTCCCC
rJMFF001K04+ TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTTAGATTTGTTGTGGGAGTCCCC
rJMSF026B02+ TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTTAGATTTGTTGTGGGAGTCCCC
rJMSF008A10+ TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTTAGATTTGTTGTGGGAGTCCCC
rJMFF006F13+ TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTTAGATTTGTTGTGGGAGTCCCC
rJMFF002I19+ TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTTAGATTTGTTGTGGGAGTCCCC
                      ____________________________________________________________
consensus TAGGCTATAGAGGAGAATTGAATTGTGTAGGGAGTGGTTAGATTTGTTGTGGGAGTCCCC
 
. : . : . : . : . : . :
rJMSF012P20+ TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
rJMFF001K04+ TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
rJMSF026B02+ TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
rJMSF008A10+ TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
rJMFF006F13+ TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
rJMFF002I19+ TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
                      ____________________________________________________________
consensus TTTTTGTTTCTGAATGGACTACATCCATAAAAATAACGAATAATTGGGCTTGTATTACAG
 
. : . : . : . : . : . :
rJMSF012P20+ AAAGACTTATTTATTTT
rJMFF001K04+ AAAGACTTATTTATTTTTTCGTTCAATATTTCGTAACA
rJMSF026B02+ AAAGACTTATTTATTTTTTCGTTCAATATTTCGTAACATTACGCTTTTTGAGGTTGCCTA
rJMSF008A10+ AAAGACTTATTTATTTTTTCGTTCAATATTTCGTAACATTACGCTTTTTGAGGTTGCCTA
rJMFF006F13+ AAAGACTTATTTATTTTTTCGTTCAATATTTCGTAACATTACGCTTTTTGAGGTTGCCTA
rJMFF002I19+ AAAGACTTATTTATTTTTTCGTTCAATATTTCGTAACATTACGCTTTTTGAGGTTGCCTA
                      ____________________________________________________________
consensus AAAGACTTATTTATTTTTTCGTTCAATATTTCGTAACATTACGCTTTTTGAGGTTGCCTA
 
. : . : . : . : . : . :
rJMSF026B02+ AATAATGAGGTTTGCCATTATGTATTGATATCAAT
rJMSF008A10+ AATAATGAGGTTTGCCATTATGTATTGATATCAAT
rJMFF006F13+ AATAATGAGGTTTGCCATTATGTATTGATATCAATTTTAGTCCTATGAGTATTAGTAAA
rJMFF002I19+ AATAATGAGGTTTGCCATTATGTATTGATATCAATTTTAGTCCTATGAGTATTAGTAAAA
                      ____________________________________________________________
consensus AATAATGAGGTTTGCCATTATGTATTGATATCAATTTTAGTCCTATGAGTATTAGTAAAA