Previous Contig 008227:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I16Sequence520008227 (4)gb:AC151804_17451477e-30Solanum demissum chromosome 5 BAC PGEC475B22 genomic sequence, complete sequence607008227 (4)pir|F84611|F846114e-09hypothetical protein At2g22350 [imported] - Arabidopsis thaliana>gb:AC006592_153
JMFF007C21Sequence580008227 (4)gb:AC151804_17451473e-50Solanum demissum chromosome 5 BAC PGEC475B22 genomic sequence, complete sequence808008683 (2)gb:AC151804_17451475e-13Solanum demissum chromosome 5 BAC PGEC475B22 genomic sequence, complete sequence
JMFF010P11Sequence589008227 (4)gb:AC151804_17451474e-50Solanum demissum chromosome 5 BAC PGEC475B22 genomic sequence, complete sequence790008683 (2)gb:AC151804_17451470.022Solanum demissum chromosome 5 BAC PGEC475B22 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010P11+ GTAACTC
                      ____________________________________________________________
consensus GTAACTC
 
. : . : . : . : . : . :
JMFF010P11+ TGAATTATATATATAGTCAGAGTTCATTTTATTGTGGATATCATTTGAGGGTCCAATTAA
JMFF007C21+ AATTATATATATAGTCAGAGTTCATTTTATTGTGGATATCATTTGAGGGTCCAATTAA
                      ____________________________________________________________
consensus TGAATTATATATATAGTCAGAGTTCATTTTATTGTGGATATCATTTGAGGGTCCAATTAA
 
. : . : . : . : . : . :
JMFF010P11+ AGGCCCATGAGAACCTTCACCAGCAGCCTCGGTCTTTAATGCTTTGCACTGTTTCTCCCA
JMFF007C21+ AGGCCCATGAGAACCTTCACCAGCAGCCTCGGTCTTTAATGCTTTGCACTGTTTCTCCCA
                      ____________________________________________________________
consensus AGGCCCATGAGAACCTTCACCAGCAGCCTCGGTCTTTAATGCTTTGCACTGTTTCTCCCA
 
. : . : . : . : . : . :
JMFF010P11+ CTTGGCGAAATCAGCCTCCGTAATCCGGTAACAATCAATCTTGTCCATTCCACCGCCATA
JMFF007C21+ CTTGGCGAAATCAGCCTCCGTAATCCGGTAACAATCAATCTTGTCCATTCCACCGCCATA
                      ____________________________________________________________
consensus CTTGGCGAAATCAGCCTCCGTAATCCGGTAACAATCAATCTTGTCCATTCCACCGCCATA
 
. : . : . : . : . : . :
JMFF010P11+ TTTCCAAAGGAATCTTTTCACTTTCTTCAAATGATCCTCGCTAGCCAGATGCGCAATCGC
JMFF007C21+ TTTCCAAAGGAATCTTTTCACTTTCTTCAAATGATCCTCGCTAGCCAGATGCGCAATCGC
                      ____________________________________________________________
consensus TTTCCAAAGGAATCTTTTCACTTTCTTCAAATGATCCTCGCTAGCCAGATGCGCAATCGC
 
. : . : . : . : . : . :
JMFF010P11+ ATTCTCACTGTTGAAGAAGCTGTGAAGCTCAGGAATATCAAATTGGCAGAAGCGGCACCA
JMFF007C21+ ATTCTCACTGTTGAAGAAGCTGTGAAGCTCAGGAATATCAAATTGGCAGAAGCGGCACCA
JMFF002I16- CTGTTGAAGAAGCTGTGAAGCTCAGGAATATCAAATTGGCAGAAGCGGCACCA
                      ____________________________________________________________
consensus ATTCTCACTGTTGAAGAAGCTGTGAAGCTCAGGAATATCAAATTGGCAGAAGCGGCACCA
 
. : . : . : . : . : . :
JMFF010P11+ GAGGCGGTTGAGAGAGGCGTGTTCGGGGCGGAGAGGGGTAGGGTTTTTGAGGGAGGAGCG
JMFF007C21+ GAGGCGGTTGAGAGAGGCGTGTTCGGGGCGGAGAGGGGTAGGGTTTTTGAGGGAGGAGCG
JMFF002I16- GAGGCGGTTGAGAGAGGCGTGTTCGGGGCGGAGAGGGGTAGGGTTTTTGAGGGAGGAGCG
                      ____________________________________________________________
consensus GAGGCGGTTGAGAGAGGCGTGTTCGGGGCGGAGAGGGGTAGGGTTTTTGAGGGAGGAGCG
 
. : . : . : . : . : . :
JMFF010P11+ GAGGTCGGCAAGCTTCGATCGAAAGCGAGAGAGCGCTGCCTCCAGCGACTTCTTGTGGTT
JMFF007C21+ GAGGTCGGCAAGCTTCGATCGAAAGCGAGAGAGCGCTGCCTCCAGCGACTTCTTGTGGTT
JMFF002I16- GAGGTCGGCAAGCTTCGATCGAAAGCGAGAGAGCGCTGCCTCCAGCGACTTCTTGTGGTT
                      ____________________________________________________________
consensus GAGGTCGGCAAGCTTCGATCGAAAGCGAGAGAGCGCTGCCTCCAGCGACTTCTTGTGGTT
 
. : . : . : . : . : . :
JMFF010P11+ GGGGAAGAAGTTGTGCCGCCGGCCTTGGTTGTGGTTCAGCTTGCAGACCTCGCAGAACTC
JMFF007C21+ GGGGAAGAAGTTGTGCCGCCGGCCTTGGTTGTGGTTCAGCTTGCAGACCTCGCAGAACTC
JMFF002I16- GGGGAAGAAGTTGTGCCGCCGGCCTTGGTTGTGGTTCAGCTTGCAGACCTCGCAGAACTC
                      ____________________________________________________________
consensus GGGGAAGAAGTTGTGCCGCCGGCCTTGGTTGTGGTTCAGCTTGCAGACCTCGCAGAACTC
 
. : . : . : . : . : . :
JMFF010P11+ AAAACCTTCATTGCTCTTCTTCTTCTTCTTCATCCGTTTCAGAACGGTTATGGAGATTTG
JMFF007C21+ AAAACCTTCATTGCTCTTCTTCTTCTTCTTCATCCGTTTCAGAACGGTTATGGAGATTTG
JMFF002I16- AAAACCTTCATTGCTCTTCTTCTTCTTCTTCATCCGTTTCAGAACGGTTATGGAGATTTG
                      ____________________________________________________________
consensus AAAACCTTCATTGCTCTTCTTCTTCTTCTTCATCCGTTTCAGAACGGTTATGGAGATTTG
 
. : . : . : . : . : . :
JMFF010P11+ CAGAGG
JMFF007C21+ CAGAGG
JMFF002I16- CAGAGGGAATGTAAGCAGGTCGTCCCTCTTCGCAATCGCAGCTTGGTGGATTTGGATTTG
rJMFF002I16+ GGATTTG
                      ____________________________________________________________
consensus CAGAGGGAATGTAAGCAGGTCGTCCCTCTTCGCAATCGCAGCTTGGTGGATTTGGATTTG
 
. : . : . : . : . : . :
JMFF002I16- GAGAAACAACAGCATTTTCAGAGGTGAGGTGATCGATACCAACAGGAAACTGGCGTGGAT
rJMFF002I16+ GAGAAACAACAGCATTTTCAGAGGTGAGGTGATCGATACCAACAGGAAACTGGCGTGGAT
                      ____________________________________________________________
consensus GAGAAACAACAGCATTTTCAGAGGTGAGGTGATCGATACCAACAGGAAACTGGCGTGGAT
 
. : . : . : . : . : . :
JMFF002I16- CAGGGAANTTGTAACAGAATGTCACAGAGCTTTAAAGAG
rJMFF002I16+ CAGGGAAGTTGTAACAGAATGTCACAGAGCTTTAAAGAGGGACATCATGAGGACCACTGG
                      ____________________________________________________________
consensus CAGGGAAGTTGTAACAGAATGTCACAGAGCTTTAAAGAGGGACATCATGAGGACCACTGG
 
. : . : . : . : . : . :
rJMFF002I16+ CNCTGCCACACTTAGAGAGCGGAATACCAGCTGGAAAGCATCGGAGAGTCATGGATGGAC
                      ____________________________________________________________
consensus CNCTGCCACACTTAGAGAGCGGAATACCAGCTGGAAAGCATCGGAGAGTCATGGATGGAC
 
. : . : . : . : . : . :
rJMFF002I16+ TCTGAACGTGGATGCTAGCGTGAAACCAACCACTCTCCAGGCTTCTGTGGAGGAGTTCTC
                      ____________________________________________________________
consensus TCTGAACGTGGATGCTAGCGTGAAACCAACCACTCTCCAGGCTTCTGTGGAGGAGTTCTC
 
. : . : . : . : . : . :
rJMFF002I16+ AAAAGAGCAAATGGTAAATGGGTTCGAGGCTTCTGTGGCAAGTCCAACCATGAAGACGCA
                      ____________________________________________________________
consensus AAAAGAGCAAATGGTAAATGGGTTCGAGGCTTCTGTGGCAAGTCCAACCATGAAGACGCA
 
. : . : . : . : . : . :
rJMFF002I16+ ACTGTTGTTAAGGCGGAGGCCATCTCAAAGGGTCTTGCTTGGGCTTGGAACCATGGTATT
                      ____________________________________________________________
consensus ACTGTTGTTAAGGCGGAGGCCATCTCAAAGGGTCTTGCTTGGGCTTGGAACCATGGTATT
 
. : . : . : . : . : . :
rJMFF002I16+ CGAGACGTTGAGATTCAATCTGATGCCAAGGGAGTTGTTCAATGGATCACTGGGACCGAT
                      ____________________________________________________________
consensus CGAGACGTTGAGATTCAATCTGATGCCAAGGGAGTTGTTCAATGGATCACTGGGACCGAT
 
. : . : . : . : . : . :
rJMFF002I16+ GAACTGAGGGGACCGCTTTGTGTTTATATGGAGGAGATTCGCGACTGGCTCACAAAGGAT
                      ____________________________________________________________
consensus GAACTGAGGGGACCGCTTTGTGTTTATATGGAGGAGATTCGCGACTGGCTCACAAAGGAT
 
. : . : . : . : . : . :
rJMFF002I16+ TGGAGGGTCTCAATCCTTAGTATCTATCGAGAATAGAACGCGAGTGCTGATGCCGCTGCG
                      ____________________________________________________________
consensus TGGAGGGTCTCAATCCTTAGTATCTATCGAGAATAGAACGCGAGTGCTGATGCCGCTGCG
 
. : . : . : . : . : . :
rJMFF002I16+ CTCTTGGGAGCGACGATGGACATGAATTGGAGGGAACTGGANAAATGTCCTATTGGTATG
                      ____________________________________________________________
consensus CTCTTGGGAGCGACGATGGACATGAATTGGAGGGAACTGGANAAATGTCCTATTGGTATG