Previous Contig 008225:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I10Sequence593000088 (2)pir|T49108|T491082e-66pectinesterase like protein - Arabidopsis thaliana>gb:ATCHRIV56_1546038 Arabidop717008225 (2)pir|T49108|T491085e-77pectinesterase like protein - Arabidopsis thaliana>gb:ATCHRIV56_1546038 Arabidop
JMSF022G03Sequence676000088 (2)pir|T49108|T491087e-70pectinesterase like protein - Arabidopsis thaliana>gb:ATCHRIV56_1546038 Arabidop751008225 (2)pir|T49108|T491081e-86pectinesterase like protein - Arabidopsis thaliana>gb:ATCHRIV56_1546038 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022G03+ GCTCCTTACATAAATGGCAAGCAGAGGTATGCTGTGAATGGTGTCTCGTTTG
                      ____________________________________________________________
consensus GCTCCTTACATAAATGGCAAGCAGAGGTATGCTGTGAATGGTGTCTCGTTTG
 
. : . : . : . : . : . :
rJMSF022G03+ TGAATCCAGACACCCCTTTAAAGCTAGCAGATTACTTCAAAATCGGGGGAGTCTTCAACC
rJMFF002I10+ ATCCAGACACCCCTTTAAAGCTAGCAGATTACTTCAAAATCGGGGGAGTCTTCAACC
                      ____________________________________________________________
consensus TGAATCCAGACACCCCTTTAAAGCTAGCAGATTACTTCAAAATCGGGGGAGTCTTCAACC
 
. : . : . : . : . : . :
rJMSF022G03+ TCGGAAGCATCCCTGACTCACCGAGATGGGGATCTGCCTATCTTGCAACCTCGGTTATGG
rJMFF002I10+ TCGGAAGCATCCCTGACTCACCGAGATGGGGATCTGCCTATCTTGCAACCTCGGTTATGG
                      ____________________________________________________________
consensus TCGGAAGCATCCCTGACTCACCGAGATGGGGATCTGCCTATCTTGCAACCTCGGTTATGG
 
. : . : . : . : . : . :
rJMSF022G03+ ATGCTAACTACAGATCTTTCGTGGAAATCGTGTTCCAAAACTGGGAGGACACTGTCCAGT
rJMFF002I10+ ATGCTAACTACAGATCTTTCGTGGAAATCGTGTTCCAAAACTGGGAGGACACTGTCCAGT
                      ____________________________________________________________
consensus ATGCTAACTACAGATCTTTCGTGGAAATCGTGTTCCAAAACTGGGAGGACACTGTCCAGT
 
. : . : . : . : . : . :
rJMSF022G03+ CCTGGCATATCGATGGATATTCTTTCTTTGTCGTCGGAATGGATGGTGGACAGTGGACTG
rJMFF002I10+ CCTGGCATATCGATGGATATTCTTTCTTTGTCGTCGGAATGGATGGTGGACAGTGGACTG
                      ____________________________________________________________
consensus CCTGGCATATCGATGGATATTCTTTCTTTGTCGTCGGAATGGATGGTGGACAGTGGACTG
 
. : . : . : . : . : . :
rJMSF022G03+ AAGCAAGCAGAACGCGTTACAACTTGAGAGACACAGTTGCCCGATGCACTGTTCAGGTGT
rJMFF002I10+ AAGCAAGCAGAACGCGTTACAACTTGAGAGACACAGTTGCCCGATGCACTGTTCAGGTGT
                      ____________________________________________________________
consensus AAGCAAGCAGAACGCGTTACAACTTGAGAGACACAGTTGCCCGATGCACTGTTCAGGTGT
 
. : . : . : . : . : . :
rJMSF022G03+ ACCCAAGATCATGGACTGCTATCTACATGGCACTGGACAATGTGGGAATGTGGAACATAA
rJMFF002I10+ ACCCAAGATCATGGACTGCTATCTACATGGCACTGGACAATGTGGGAATGTGGAACATAA
                      ____________________________________________________________
consensus ACCCAAGATCATGGACTGCTATCTACATGGCACTGGACAATGTGGGAATGTGGAACATAA
 
. : . : . : . : . : . :
rJMSF022G03+ GGTCTGAGGACTGGGCAAGGCAGTATTTGGGACAGCAATTTTACTTGAGAGTTTACACTT
rJMFF002I10+ GGTCTGAGGACTGGGCAAGGCAGTATTTGGGACAGCAATTTTACTTGAGAGTTTACACTT
                      ____________________________________________________________
consensus GGTCTGAGGACTGGGCAAGGCAGTATTTGGGACAGCAATTTTACTTGAGAGTTTACACTT
 
. : . : . : . : . : . :
rJMSF022G03+ CTACAAACTCATATAGGGATGAGCTTCCAATCCCCAAGAATGCTCTTCTCTGCGGTCGAG
rJMFF002I10+ CTACAAACTCATATAGGGATGAGCTTCCAATCCCCAAGAATGCTCTTCTCTGCGGTCGAG
                      ____________________________________________________________
consensus CTACAAACTCATATAGGGATGAGCTTCCAATCCCCAAGAATGCTCTTCTCTGCGGTCGAG
 
. : . : . : . : . : . :
rJMSF022G03+ CAAGAGGACGCCATACCAGACCACTTTAG
rJMFF002I10+ CAAGAGGACGCCATACCAGACCACTTTAGATTGAACCAGAAAAACGTACTTGAGTCTGTC
                      ____________________________________________________________
consensus CAAGAGGACGCCATACCAGACCACTTTAGATTGAACCAGAAAAACGTACTTGAGTCTGTC
 
. : . : . : . : . : . :
rJMFF002I10+ ACGATAATGTGACCGGGGAAATGCCATCTACAGCAAGAGGAATGAAGGAAGCCAGAAAAT
                      ____________________________________________________________
consensus ACGATAATGTGACCGGGGAAATGCCATCTACAGCAAGAGGAATGAAGGAAGCCAGAAAAT
 
. : . : . : . : . : . :
rJMFF002I10+ ATGTTAGGGGAGCTCAACTCGAGCTACAATCTAATTCTTTGTAATTTTTCATGATGCTTT
                      ____________________________________________________________
consensus ATGTTAGGGGAGCTCAACTCGAGCTACAATCTAATTCTTTGTAATTTTTCATGATGCTTT
 
. : . : . : . : . : . :
rJMFF002I10+ GGTGGAAGCTATAACAACAAATAATTTGTGAACACAATATTTAATTCTGGAATAAATAAT
                      ____________________________________________________________
consensus GGTGGAAGCTATAACAACAAATAATTTGTGAACACAATATTTAATTCTGGAATAAATAAT