Previous Contig 008222:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H08Sequence560000086 (5)gb:AF101426_17681620.001Cichorium intybus ferrochelatase mRNA, partial cds.748008222 (6)sp|P42044|HEMZ_CUCSA3e-77Ferrochelatase II, chloroplast precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (
JMSF002P18Sequence235000086 (5)713008222 (6)sp|P42044|HEMZ_CUCSA3e-73Ferrochelatase II, chloroplast precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (
JMSF003P18Sequence222000086 (5)483008222 (6)gb:AP004756_18444846e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P059
JMSF010J14Sequence448000086 (5)740008222 (6)sp|P42044|HEMZ_CUCSA2e-76Ferrochelatase II, chloroplast precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (
JMSF010K14Sequence444000086 (5)767008222 (6)sp|P42044|HEMZ_CUCSA4e-79Ferrochelatase II, chloroplast precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (
JMSF027O06Sequence651019492gb:AF101426_17681624e-38Cichorium intybus ferrochelatase mRNA, partial cds.702008222 (6)sp|P42044|HEMZ_CUCSA6e-75Ferrochelatase II, chloroplast precursor (EC 4.99.1.1) (Protoheme ferro-lyase) (

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010J14+ CGATGAGGCAATGATTTTNTTCAGTGCCCATG
rJMSF010K14+ GAAGAGTTGCACAAATTTCCAGAGNCCCGATGAGGCAATGATTTTCTTCAGTGCCCATG
rJMSF002P18+ CATG
rJMSF027O06+ TTCAGTGCCCATG
rJMFF002H08+ CGATGAGGCAATGATTTTTTTCAGTGCCCATG
                      ____________________________________________________________
consensus GAAGAGTTGCACAAATTTCCAGAGNCCCGATGAGGCAATGATTTTTTTCAGTGCCCATG
 
. : . : . : . : . : . :
rJMSF010J14+ GAGTACCTGTCAGTTATGTTGAGGAGGCAGGTGATCCATACAGGGATCAGATGGAAGAGT
rJMSF010K14+ GAGTACCTGTCAGTTATGTTGAGGAGGCAGGTGATCCATACAGGGATCAGATGGAAGAGT
rJMSF002P18+ GAGTACCTGTCAGTTATGTTGAGGAGGCAGGTGATCCATACAGGGATCAGATGGAAGAGT
rJMSF027O06+ GAGTACCTGTCAGTTATGTTGAGGAGGCAGGTGATCCATACAGGGATCAGATGGAAGAGT
rJMFF002H08+ GAGTACCTGTCAGTTATGTTGAGGAGGCAGGTGATCCATACAGGGATCAGATGGAAGAGT
                      ____________________________________________________________
consensus GAGTACCTGTCAGTTATGTTGAGGAGGCAGGTGATCCATACAGGGATCAGATGGAAGAGT
 
. : . : . : . : . : . :
rJMSF010J14+ GCATTTCCCTGATCATGCAAGAACTGAAAGCAAGGGGAACTAACAATGATCATACTTTGG
rJMSF010K14+ GCATTTCCCTGATCATGCAAGAACTGAAAGCAAGGGGAACTAACAATGATCATACTTTGG
rJMSF002P18+ GCATTTCCCTGATCATGCAAGAACTGAAAGCAAGGGGAACTAACAATGATCATACTTTGG
rJMSF027O06+ GCATTTCCCTGATCATGCAAGAACTGAAAGCAAGGGGAACTAACAATGATCATACTTTGG
rJMFF002H08+ GCATTTCCCTGATCATGCAAGAACTGAAAGCAAGGGGAACTAACAATGATCATACTTTGG
                      ____________________________________________________________
consensus GCATTTCCCTGATCATGCAAGAACTGAAAGCAAGGGGAACTAACAATGATCATACTTTGG
 
. : . : . : . : . : . :
rJMSF010J14+ CGTACCAGAGCCGGGTTGGACCTGTACAGTGGCTGAAACCTTACACTGATGAAGTTCTTG
rJMSF010K14+ CGTACCAGAGCCGGGTTGGACCTGTACAGTGGCTGAAACCTTACACTGATGAAGTTCTTG
rJMSF002P18+ CGTACCAGAGCCGGGTTGGACCTGTACAGTGGCTGAAACCTTACACTGATGAAGTTCTTG
rJMSF027O06+ CGTACCAGAGCCGGGTTGGACCTGTACAGTGGCTGAAACCTTACACTGATGAAGTTCTTG
rJMFF002H08+ CGTACCAGAGCCGGGTTGGACCTGTACAGTGGCTGAAACCTTACACTGATGAAGTTCTTG
                      ____________________________________________________________
consensus CGTACCAGAGCCGGGTTGGACCTGTACAGTGGCTGAAACCTTACACTGATGAAGTTCTTG
 
. : . : . : . : . : . :
rJMSF010J14+ TTGAACTTGGCCAGAAAGGTGTGAAATCTCTGTTGGCTGTTCCAGTGAGCTTCGTGAGTG
rJMSF010K14+ TTGAACTTGGCCAGAAAGGTGTGAAATCTCTGTTGGCTGTTCCAGTGAGCTTCGTGAGTG
rJMSF003P18+ CAGTGAGCTTCGTGAGTG
rJMSF002P18+ TTGAACTTGGCCAGAAAGGTGTGAAATCTCTGTTGGCTGTTCCAGTGAGCTTCGTGAGTG
rJMSF027O06+ TTGAACTTGGCCAGAAAGGTGTGAAATCTCTGTTGGCTGTTCCAGTGAGCTTCGTGAGTG
rJMFF002H08+ TTGAACTTGGCCAGAAAGGTGTGAAATCTCTGTTGGCTGTTCCAGTGAGCTTCGTGAGTG
                      ____________________________________________________________
consensus TTGAACTTGGCCAGAAAGGTGTGAAATCTCTGTTGGCTGTTCCAGTGAGCTTCGTGAGTG
 
. : . : . : . : . : . :
rJMSF010J14+ AGCACATAGAGACTCTTGAAGAGATTGATATGGAGTACAGAGAGTTGGCACTTGAATCTG
rJMSF010K14+ AGCACATAGAGACTCTTGAAGAGATTGATATGGAGTACAGAGAGTTGGCACTTGAATCTG
rJMSF003P18+ AGCACATAGAGNCTCTTGNAGAGANTGATATGGAGTACAGAGAGTTGGCACCNGAATCTG
rJMSF002P18+ AGCACATAGAGACTCTTGAAGAGATTGATATGGAGTACAGAGAGTTGGCACTTGAATCTG
rJMSF027O06+ AGCACATAGAGACTCTTGAAGAGATTGATATGGAGTACAGAGAGTTGGCACTTGAATCTG
rJMFF002H08+ AGCACATAGAGACTCTTGAAGAGATTGATATGGAGTACAGAGAGTTGGCACTTGAATCTG
                      ____________________________________________________________
consensus AGCACATAGAGACTCTTGAAGAGATTGATATGGAGTACAGAGAGTTGGCACTTGAATCTG
 
. : . : . : . : . : . :
rJMSF010J14+ GAGTTGTAAATTGGGGGCGGGTACCCGCTTTGAATTGCACCTCCTCTTTCATCACTGATC
rJMSF010K14+ GAGTTGTAAATTGGGGGCGGGTACCCGCTTTGAATTGCACCTCCTCTTTCATCACTGATC
rJMSF003P18+ GAGTTGTAAATTGGGGGCGGGTACCCGCTTCGAATNGCACCTCCTCTTTCATCANTGATN
rJMSF002P18+ GAGTTGTAAATTGGGGGCGGGTACCCGCTTTGAATTGCACCTCCTCTTTCATCACTGATC
rJMSF027O06+ GAGTTGTAAATTGGGGGCGGGTACCCGCTTTGAATTGCACCTCCTCTTTCATCACTGATC
rJMFF002H08+ GAGTTGTAAATTGGGGGCGGGTACCCGCTTTGAATTGCACCTCCTCTTTCATCACTGATC
                      ____________________________________________________________
consensus GAGTTGTAAATTGGGGGCGGGTACCCGCTTTGAATTGCACCTCCTCTTTCATCACTGATC
 
. : . : . : . : . : . :
rJMSF010J14+ TCGCAGATGCAGTGATCGAAGCACTTCCATCAGCAATGGCAATGTCGTCGTCTACATCCA
rJMSF010K14+ TCGCAGATGCAGTGATCGAAGCACTTCCATCAGCAATGGCAATGTCGTCGTCTACATCCA
rJMSF003P18+ TNGCAGATGCAGTGATNGAAGCACTTCCATCAGCAATGGCAATGTNGTNGTGNACATCCA
rJMSF002P18+ TCGCAGATGCAGTGATCGAAGCACTTCCATCAGCAATGGCAATGTCGTCGTCTACATCCA
rJMSF027O06+ TCGCAGATGCAGTGATCGAAGCACTTCCATCAGCAATGGCAATGTCGTCGTCTACATCCA
rJMFF002H08+ TCGCAGATGCAGTGATCGAAGCACTTCCATCAGCAATGGCAATGTCGTCGTCTACATCCA
                      ____________________________________________________________
consensus TCGCAGATGCAGTGATCGAAGCACTTCCATCAGCAATGGCAATGTCGTCGTCTACATCCA
 
. : . : . : . : . : . :
rJMSF010J14+ ACATGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTTTGGCT
rJMSF010K14+ ACATGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTTTGGCT
rJMSF003P18+ ACANGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTNTGGCT
rJMSF002P18+ ACATGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTTTGGCT
rJMSF027O06+ ACATGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTTTGGCT
rJMFF002H08+ ACATGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTTTGGCT
                      ____________________________________________________________
consensus ACATGGAAGAAACTGACAGCATGGATCCTATGCAATATCTTATTAAAGTGGTGTTTGGCT
 
. : . : . : . : . : . :
rJMSF010J14+ CAATTTTGGCATTTGTTTTGCTCTTCTCACCAAAGATGCTGTCAGCATTCAAGAATCAAA
rJMSF010K14+ CAATTTTGGCATTTGTTTTGCTCTTCTCACCAAAGATGCTGTCAGCATTCAAGAATCAAA
rJMSF003P18+ CAATTTTGGCATTTGTTNTGCTCTTCTCACCAAAGATGCTNTCAGCATTCAAGAATCAAA
rJMSF002P18+ CAATTTTGGCATTTGTTTTGCTCTTCTCACCAAAGATGCTGTCAGCATTCAAGAATCAAA
rJMSF027O06+ CAATTTTGGCATTTGTTTTGCTCTTCTCACCAAAGATGCTGTCAGCATTCAAGAATCAAA
rJMFF002H08+ CAATTTTGGCATTTGTTTTGCTCTTCTCACCAAAGATGCTGTCAGCATTCAAGAATCAAA
                      ____________________________________________________________
consensus CAATTTTGGCATTTGTTTTGCTCTTCTCACCAAAGATGCTGTCAGCATTCAAGAATCAAA
 
. : . : . : . : . : . :
rJMSF010J14+ TCCTTTAAAGAAGAGGATTGTGATTGATGGAGGCATATTAATTAGTTTAGGATACAGCAA
rJMSF010K14+ TCCTTTAAAGAAGAGGATTGTGATTGATGGAGGCATATTAATTAGTTTAGGATACAGCAA
rJMSF003P18+ TCCTTTAAAGANGNGGATTGTGATTGATGGAGGCATATTAATTAGTTTNGGATACAGCAA
rJMSF002P18+ TCCTTTAAAGAAGAGGATTGTGATTGATGGAGGCATATTAATTAGTTTAGGATACAGCAA
rJMSF027O06+ TCCTTTAAAGAAGAGGATTGTGATTGATGGAGGCATATTAATTAGTTTAGGATACAGCAA
rJMFF002H08+ TCCTTTAAAGAAGAGGATTGTGATTGATGGAGGCATATTAATTAGTTTAGGATACAGCAA
                      ____________________________________________________________
consensus TCCTTTAAAGAAGAGGATTGTGATTGATGGAGGCATATTAATTAGTTTAGGATACAGCAA
 
. : . : . : . : . : . :
rJMSF010J14+ -CAAGTGAAGTGCTTGGGCA-TGGGCCTTTTTGGTCCTAGCAGTAAGAAGGGCATATAAA
rJMSF010K14+ -CAAGTGAAGTGCTTGGGCA-TGGGCCTTTTTGGTCCTAGCAGTAAGAAGGGCATATAAA
rJMSF003P18+ GCAAGNGAAGTGCTTGGGCACTGGGCCTTTTCGGTCCTAGCAGTAAGAAGGGCATANAAA
rJMSF002P18+ -CAAGTGAAGTGCTTGGGCA-TGGGCCTTTTTGGTCCTAGCAGTAAGAAGGGCATATAAA
rJMSF027O06+ -CAAGTGAAGTGCTTGGGCA-TGGGCCTTTTTGGTCCTAGCAGTAAGAAGGGCATATAAA
rJMFF002H08+ -CAAGTGAAGTGCTTGGGCA-TGGGCCTTTTTGGTCCTAGCAGTAAGAAGGGCATATAAA
                      ____________________________________________________________
consensus -CAAGTGAAGTGCTTGGGCA-TGGGCCTTTTTGGTCCTAGCAGTAAGAAGGGCATATAAA
 
. : . : . : . : . : . :
rJMSF010J14+ TA-ATTCATACATTTTGTAACATCTTTTTGTAGAGAAAAC
rJMSF010K14+ TA-ATTCATACATTTTGTAACATCTTTTTGTAGAGAAAAC
rJMSF003P18+ TACATTCATACATTNTGTANCATCTTTTNGTAGA
rJMSF002P18+ TA-ATTCATACATTTTGTAACATCTTTTTGTAGAGAAAACCAGTCAT
rJMSF027O06+ TA-ATTCATACATTTTGTAACATCTTTT
rJMFF002H08+ TA-ATTCATACATTTTGTAACATCTTTTTGTAGAGAAAA-CAGTCATTGAACATGGTTTT
                      ____________________________________________________________
consensus TA-ATTCATACATTTTGTAACATCTTTTTGTAGAGAAAACCAGTCATTGAACATGGTTTT