Previous Contig 008221:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002F19Sequence557014078762008221 (3)pir|D96499|D964993e-54probable UDP-glucose,sterol glucosyltransferase [imported] - Arabidopsis thalian
JMFS082C12Sequence516008221 (3)pir|D96499|D964993e-32probable UDP-glucose,sterol glucosyltransferase [imported] - Arabidopsis thalian
JMSF012P11Sequence453005359 (2)152008221 (3)pir|D96499|D964990.008probable UDP-glucose,sterol glucosyltransferase [imported] - Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002F19+ CCACAGACATAATTCTGGAAGCACTGAAAGTTACCGGACAGAGG
                      ____________________________________________________________
consensus CCACAGACATAATTCTGGAAGCACTGAAAGTTACCGGACAGAGG
 
. : . : . : . : . : . :
rJMFF002F19+ GGAATTATTGACCAAGGTTGGGGAGGTCTTGGTACTTTACCAGAAATTCCTGAAACTGTT
                      ____________________________________________________________
consensus GGAATTATTGACCAAGGTTGGGGAGGTCTTGGTACTTTACCAGAAATTCCTGAAACTGTT
 
. : . : . : . : . : . :
rJMFF002F19+ TATACGCTTTCGGATTGCCCTCATGACTGGCTTTTCCTGCAATGCTCAGCTGTGGTTCAT
                      ____________________________________________________________
consensus TATACGCTTTCGGATTGCCCTCATGACTGGCTTTTCCTGCAATGCTCAGCTGTGGTTCAT
 
. : . : . : . : . : . :
JMFS082C12+ ATCGTA
rJMFF002F19+ CATGGTGGTGCCGGAACCACGGCTGCAGGGCTACGGGCTGGGTGTCCAACAACTATCGTA
                      ____________________________________________________________
consensus CATGGTGGTGCCGGAACCACGGCTGCAGGGCTACGGGCTGGGTGTCCAACAACTATCGTA
 
. : . : . : . : . : . :
JMFS082C12+ CCATTGTTCGGAGATCAATTGGTCTGGGGTGACAGACTTCTTCAGAAGGGTCTGGGCCCC
rJMFF002F19+ CCATTCTTCGGAGATCAATTTTTCTGGGGTGACAGACTTCATCAGAAGGGACTCGGACCA
                      ____________________________________________________________
consensus CCATTGTTCGGAGATCAATTTTTCTGGGGTGACAGACTTCTTCAGAAGGGTCTGGGCCCC
 
. : . : . : . : . : . :
JMFS082C12+ CCTCCAATTCCTATATCTCAGCTCACTGTCCAAGGCTTATTTGAGGCTATAAGATTCATG
rJMSF012P11+ TGAGGCTATAAGATTCATG
rJMFF002F19+ CCTCCAATTCCTATATCTCAGCTCACTGTCGAAGGCTTATCTGAGGCTATAAGATTCATG
                      ____________________________________________________________
consensus CCTCCAATTCCTATATCTCAGCTCACTGTCGAAGGCTTATTTGAGGCTATAAGATTCATG
 
. : . : . : . : . : . :
JMFS082C12+ CTCCAGCCTGAGGTGAAATCCCGAGTAATGGAGCTAGCAGGGTTAGTGGATATCGATGAT
rJMSF012P11+ CTCCAACCTGNGGTGAAATCANGAGTAATGGAGCTANCAAGGCTAGTGGATAGCGATGAT
rJMFF002F19+ CTCCAACCTGAGGTGAAATCACGAGTAATGGAGCTAGCAAGGCTAGTGGATAGCGATGAT
                      ____________________________________________________________
consensus CTCCAACCTGAGGTGAAATCACGAGTAATGGAGCTAGCAAGGCTAGTGGATAGCGATGAT
 
. : . : . : . : . : . :
JMFS082C12+ GGAGTTTCAGGTGCTGTTCATGCTTTTCATCGCCATTTACCCACAGAGCTACCATTACCA
rJMSF012P11+ GGNGTTTCAGNTGCTGTTGANGCTNNTCATCGCCANTTACCCACAGAG
rJMFF002F19+ GGAGTTTCAGGTGCTGTTGATGCTTTTCATCGCCATTTACCCACAGAGCTACCATTACCA
                      ____________________________________________________________
consensus GGAGTTTCAGGTGCTGTTGATGCTTTTCATCGCCATTTACCCACAGAGCTACCATTACCA
 
. : . : . : . : . : . :
JMFS082C12+ GCCGGCCCACCTTCTGTGGAAGAAACTGAAAGTCCGAATCCTGGGCCATGGCTTTTTATA
rJMFF002F19+ ACCGGCCCACCTTCTGTGGAAGAAACTGAAAGTCCGAATCCTTTGCAATGGCTTTTTATA
                      ____________________________________________________________
consensus GCCGGCCCACCTTCTGTGGAAGAAACTGAAAGTCCGAATCCTTTGCCATGGCTTTTTATA
 
. : . : . : . : . : . :
JMFS082C12+ AAGATTGCCAGCCTCTGTTCCCTGGCTTGTGGCTCTAAATGTTAGGTTTGGAACCCATTA
rJMFF002F19+ AAGATTGGCAGCCTCTGTTCCCTGGCTTGTGGCTCTAAATCTTAGGTTTTGAAGACATTA
                      ____________________________________________________________
consensus AAGATTGGCAGCCTCTGTTCCCTGGCTTGTGGCTCTAAATGTTAGGTTTTGAAGCCATTA
 
. : . : . : . : . : . :
JMFS082C12+ TTCAGCCATACATAGGTTGTCCTGTTCATGCCTTCATCATATCCATCCTTCCATTTTATT
rJMFF002F19+ TACAGCCATACATTTGTTCTTCTGTTCATGCTTTCATCATATCCATCATT-CATTTTATT
                      ____________________________________________________________
consensus TTCAGCCATACATTTGTTGTTCTGTTCATGCTTTCATCATATCCATCCTTCCATTTTATT
 
. : . : . : . : . : . :
JMFS082C12+ CCATAGAAATAAGGGGATTTATCTGTTCACATGTGTTTCATCGTCAAATGTAGTGAATAG
rJMFF002F19+ -CATAGAAATAAGGGAATTTATCTGTTCATATGTGTTTCATAGTCAGATGTAGTGAATAG
                      ____________________________________________________________
consensus CCATAGAAATAAGGGGATTTATCTGTTCATATGTGTTTCATCGTCAGATGTAGTGAATAG
 
. : . : . : . : . : . :
JMFS082C12+ GAATATACTGCGTTTAGGCTTTT
rJMFF002F19+ GATTATATTGTGTTGAGGCTTTTCTGTAATAATTGATTATTTGATTTGGGAATGCAACTC
                      ____________________________________________________________
consensus GATTATATTGTGTTTAGGCTTTTCTGTAATAATTGATTATTTGATTTGGGAATGCAACTC