Previous Contig 008220:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002F17Sequence574007552 (4)pir|G96655|G966552e-67unknown protein, 29405-27288 [imported] - Arabidopsis thaliana>gb:AE005173_89397777008220 (5)gb:AY093087_15750412e-70Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762
JMFF005G09Sequence505007552 (4)pir|G96655|G966553e-39unknown protein, 29405-27288 [imported] - Arabidopsis thaliana>gb:AE005173_89397721008220 (5)gb:AY093087_15750414e-72Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762
JMFF018F15Sequence597007552 (4)gb:AY093087_15750416e-80Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762781008220 (5)gb:AY093087_15750414e-72Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762
JMFF032D03Sequence511008220 (5)gb:AY093087_15750412e-46Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762
JMSF043G20Sequence689007552 (4)gb:AY093087_15750412e-75Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762712008220 (5)gb:AY093087_15750413e-69Arabidopsis thaliana unknown protein (At1g12640) mRNA, complete cds.>gb:AY128762

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018F15+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
rJMFF005G09+ TGCAAAAAATGTAGACATATTGGGTGTTGAACTGGCTAAGAGTTCAGTTCAAATACC
rJMSF043G20+ GTAGACATATTGGGTGNTGAACTGGCTAAGAGTTCAGTTCAAATACC
rJMFF018F15+ CCGTGCAAAAAATGTAGACATATTGGGTGTTGAACTGGCTAAGAGTTCAGTTCAAATACC
rJMFF002F17+ TGCAAAAAATGTAGACATATTGGGTGTTGAACTGGCTAAGAGTTCAGTTCAAATACN
                      ____________________________________________________________
consensus CCGTGCAAAAAATGTAGACATATTGGGTGTTGAACTGGCTAAGAGTTCAGTTCAAATACC
 
. : . : . : . : . : . :
rJMFF005G09+ TCTTGTATGGAACATACAAGTCAGCACCTGGCTACGGCATTATGTCTATGAGAGGCTCAT
rJMSF043G20+ TCTTGTATGGAACATACAAGTCAGCACCTGGCTACGGCATTATGTCTATGAGAGGCTCAT
rJMFF018F15+ TCTTGTATGGAACATACAAGTCAGCACCTGGCTACGGCATTATGTCTATGAGAGGCTCAT
rJMFF002F17+ TCTTGTATGGAACATACAAGTCAGCACCTGGCTACGGCATTATGTCTATGAGAGGCTCAT
                      ____________________________________________________________
consensus TCTTGTATGGAACATACAAGTCAGCACCTGGCTACGGCATTATGTCTATGAGAGGCTCAT
 
. : . : . : . : . : . :
rJMFF005G09+ TCGCAAGGGCAAGAAGCCTGGTTTCTTCCAGTTGTTGGCTACTCAGACTGTCAGTGCTGT
rJMSF043G20+ TCGCAAGGGCAAGAAGCCTGGTTTCTTCCAGTTGTTGGCTACTCAGACTGTCAGTGCTGT
rJMFF018F15+ TCGCAAGGGCAAGAAGCCTGGTTTCTTCCAGTTGTTGGCTACTCAGACTGTCAGTGCTGT
rJMFF032D03+ AGCCTGGTTTCTTCCAGTTGTTGGCTACTCAGACTGTCAGTGCTGT
rJMFF002F17+ TCGCAAGGGCAAGAAGCCTGGTTTCTTCCAGTTGTTGGCTACTCAGACTGTCAGTGCTGT
                      ____________________________________________________________
consensus TCGCAAGGGCAAGAAGCCTGGTTTCTTCCAGTTGTTGGCTACTCAGACTGTCAGTGCTGT
 
. : . : . : . : . : . :
rJMFF005G09+ GTGGCATGGCTTATACCCTGGGTATATTTTTTTCTTTGTTCAATCTGCTCTTATGATTAA
rJMSF043G20+ GTGGCATGGCTTATACCCTGGGTATATTTTTTTCTTTGTTCAATCTGCTCTTATGATTAA
rJMFF018F15+ GTGGCATGGCTTATACCCTGGGTATATTTTTTTCTTTGTTCAATCTGCTCTTATGATTAA
rJMFF032D03+ GTGGCATGGCTTATACCCTGGGTATATTTTTTTCTTTGTTCAATCTGCTCTTATGATTAA
rJMFF002F17+ GTGGCATGGCTTATACCCTGGGTATATTTTTTTCTTTGTTCAATCTGCTCTTATGATTAA
                      ____________________________________________________________
consensus GTGGCATGGCTTATACCCTGGGTATATTTTTTTCTTTGTTCAATCTGCTCTTATGATTAA
 
. : . : . : . : . : . :
rJMFF005G09+ TGGTTCGAGAGTCATTTACAGATGGCAGCAGGCTATTGGTAATGCTCTCCTTCGGAACAT
rJMSF043G20+ TGGTTCGAGAGTCATTTACAGATGGCAGCAGGCTATTGGTAATGCTCTCCTTCGGAACAT
rJMFF018F15+ TGGTTCGAGAGTCATTTACAGATGGCAGCAGGCTATTGGTAATGCTCTCCTTCGGAACAT
rJMFF032D03+ TGGTTCGAGAGTCATTTACAGATGGCAGCAGGCTATTGGTAATGCTCTCCTTCGGAACAT
rJMFF002F17+ TGGTTCGAGAGTCATTTACAGATGGCAGCAGGCTATTGGTAATGCTCTCCTTCGGAACAT
                      ____________________________________________________________
consensus TGGTTCGAGAGTCATTTACAGATGGCAGCAGGCTATTGGTAATGCTCTCCTTCGGAACAT
 
. : . : . : . : . : . :
rJMFF005G09+ TCTAGTGTTTATGAACTTTGCCTACACTGTTCTGGTTCTCAATTACTCTTGTGTTGGTTT
rJMSF043G20+ TCTAGTGTTTATGAACTTTGCCTACACTGTTCTGGTTCTCAATTACTCTTGTGTTGGTTT
rJMFF018F15+ TCTAGTGTTTATGAACTTTGCCTACACTGTTCTGGTTCTCAATTACTCTTGTGTTGGTTT
rJMFF032D03+ TNTAGTGTTTATGAACTTTGCCTACACTGTTCTGGTTCTCAATTACTCTNGTGTTGGTTT
rJMFF002F17+ TCTAGTGTTTATGAACTTTGCCTACACTGTTCTGGTTCTCAATTACTCTTGTGTTGGTTT
                      ____________________________________________________________
consensus TCTAGTGTTTATGAACTTTGCCTACACTGTTCTGGTTCTCAATTACTCTTGTGTTGGTTT
 
. : . : . : . : . : . :
rJMFF005G09+ CATGGTATTGAGCCTCCATGAAACACTTGCTTCGTATGGCAGTGTATACTATGTTGGAAC
rJMSF043G20+ CATGGTATTGAGCCTCCATGAAACACTTGCTTCGTATGGCAGTGTATACTATGTTGGAAC
rJMFF018F15+ CATGGTATTGAGCCTCCATGAAACACTTGCTTCGTATGGCAGTGTATACTATGTTGGAAC
rJMFF032D03+ CATGGTATTGAGCCTCCATGAAACNCTNGCTTCGTATGGCAGTGTATACTATGNTGGAAC
rJMFF002F17+ CATGGTATTGAGCCTCCATGAAACACTTGCTTCGTATGGCAGTGTATACTATGTTGGAAC
                      ____________________________________________________________
consensus CATGGTATTGAGCCTCCATGAAACACTTGCTTCGTATGGCAGTGTATACTATGTTGGAAC
 
. : . : . : . : . : . :
rJMFF005G09+ AGTTATACCTATTGCATTGATCCTTCTTGGTAATGTAATTAAACCAGCCAGGCCAACGAG
rJMSF043G20+ AGTTATACCTATTGCATTGATCCTTCTTGGTAATGTAATTAAACCAGCCAGGCCAACGAG
rJMFF018F15+ AGTTATACCTATTGCATTGATCCTTCTTGGTAATGTAATTAAACCAGCCAGGCCAACGAG
rJMFF032D03+ AGTTATACCTATTGCATTGATCCTTCTTGGTAATGTAATTAAACCAGCCAGGCCAACGAG
rJMFF002F17+ AGTTATACCTATTGCATTGATCCTTCTTGGTAATGTAATTAAACCAGCCAGGCCAACGAG
                      ____________________________________________________________
consensus AGTTATACCTATTGCATTGATCCTTCTTGGTAATGTAATTAAACCAGCCAGGCCAACGAG
 
. : . : . : . : . : . :
rJMFF005G09+ ATCCAATGCTCGGAAAGATCAGTGAGTTAGGAATTGTTTTTCAAAGATTGTTTCTGAGAT
rJMSF043G20+ ATCCAATGCTCGGAAAGATCAGTAAGTTAGGAATTGTTTTTCAAAGATTGTTTCTGAGAT
rJMFF018F15+ ATCCAATGCTCGGAAAGATCAGTGAGTTAGGAATTGTTTTTCAAAGATTGTTTCTGAGAT
rJMFF032D03+ ATCCAATGCTCGGAAAGATCAGTGAGTTAGGAATTGTTTTTCAAAGATTGTTTCTGAGAT
rJMFF002F17+ ATCCAATGCTCGGAAAGATCAGTGAGTTAGGAATTGTTTTTCAAAGATTGTTTCTGAGAT
                      ____________________________________________________________
consensus ATCCAATGCTCGGAAAGATCAGTGAGTTAGGAATTGTTTTTCAAAGATTGTTTCTGAGAT
 
. : . : . : . : . : . :
rJMFF005G09+ TAGAACTTAGATCTTATATCACCTATTTGCTTTGCGAGCATGTGTAGCCCCATTTGAACG
rJMSF043G20+ TAGAACTTAGATCTTATATCACCTATTTGCTTTGCGAGCATGTGTAGCCCCATTTGAACG
rJMFF018F15+ TAGAACTTAGATCTTATATCACCTATTTGCTTTGCGAGCATGTGTAGCCCCATTTGAACG
rJMFF032D03+ TAGAACTTAGATCTTATATCACCTATNTGNTTTGCGAGCATGTGTAGCCCCATTNGAANG
rJMFF002F17+ TAGAACTTAGATCTTATATCACCTATTTGCTTTGCGAGCATGTGTAGCCCCATTTGAACG
                      ____________________________________________________________
consensus TAGAACTTAGATCTTATATCACCTATTTGCTTTGCGAGCATGTGTAGCCCCATTTGAACG
 
. : . : . : . : . : . :
rJMFF005G09+ ATAAAGATTCTTTGCCCTCGTTTTATTGGCATTGTGATTTTCGTTTTCGATTACAGTCAA
rJMSF043G20+ ATAAAGATTCTTTGCCCTCGTTTTATTGGCATTGTGATTTTCGTTTTCGATTACAGTCAA
rJMFF018F15+ ATAAAGATTCTTTGCCCTCGTTTTATTGGCATTGTGATTTTCGTTTTCGATTACAGTCAA
rJMFF032D03+ ATAAAGATTNNTTGCCCTCGTTTTATTGGCATTGTGATTTTCGTT
rJMFF002F17+ ATAAAGATTCTTTGCCCTCGTTTTATTGGCATTGTGATTTTCGTTTTCGATTACAGTCAA
                      ____________________________________________________________
consensus ATAAAGATTCTTTGCCCTCGTTTTATTGGCATTGTGATTTTCGTTTTCGATTACAGTCAA
 
. : . : . : . : . : . :
rJMFF005G09+ CAACAATTATTAACCCTAACTGTATTACTGATTGAAAGTTTCGGTGCTGGAAGGATT
rJMSF043G20+ CAACAATTATTAACCCTAACTGTATTACTGATTGAAAGTTTCGGTGCTGGAAGGATT
rJMFF018F15+ CAACAATTATTAACCCTAACTGTATTACTGATTGAAAGTTTCGGTGCTGGAAGGATTTGA
rJMFF002F17+ CAACAATTATTAACCCTAACTGTATTACTGATTGAAAGTTTCGGTGCTGGAAGGATTTGA
                      ____________________________________________________________
consensus CAACAATTATTAACCCTAACTGTATTACTGATTGAAAGTTTCGGTGCTGGAAGGATTTGA
 
. : . : . : . : . : . :
rJMFF018F15+ AATGATTGTGTAATACACAATCCATTAAAATTCTTCGCCCGTGCTTGATGGAAGTCAAAG
rJMFF002F17+ AATGATTGTGTAATACACAATCCATTAAAATTCTTCGCCCGTGCTTGATGGAAGTCAAAG
                      ____________________________________________________________
consensus AATGATTGTGTAATACACAATCCATTAAAATTCTTCGCCCGTGCTTGATGGAAGTCAAAG