Previous Contig 008218:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002F14Sequence608008218 (4)gb:AB009052_15106711e-80Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNF13.>gb:AY074299_1567768008218 (4)gb:AY087504_15725352e-69Arabidopsis thaliana clone 36094 mRNA, complete sequence.
JMFF022J20Sequence461008218 (4)gb:AB009052_15106718e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNF13.>gb:AY074299_1567598008218 (4)gb:ATH278910_15522675e-55Arabidopsis thaliana mRNA for mitochondrial succinate dehydrogenase iron-sulphur

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF002F14- ATTGGTTTTCCGGCCATGGCGTCCAGTTTGGTCCGACGA
                      ____________________________________________________________
consensus ATTGGTTTTCCGGCCATGGCGTCCAGTTTGGTCCGACGA
 
. : . : . : . : . : . :
JMFF002F14- GCGATAACTAAGGTGTCATCCTCCCCGGCGGCGAAGATGACTTTGGCGAGAGCCCACGCT
                      ____________________________________________________________
consensus GCGATAACTAAGGTGTCATCCTCCCCGGCGGCGAAGATGACTTTGGCGAGAGCCCACGCT
 
. : . : . : . : . : . :
JMFF022J20- AAGTTCCAAATTTAC
JMFF002F14- TCGGAGGCGAATGCCCCGCAGGCGACGGCGAGCGCGAAAATCAAGAAGTTCCAAATTTAC
                      ____________________________________________________________
consensus TCGGAGGCGAATGCCCCGCAGGCGACGGCGAGCGCGAAAATCAAGAAGTTCCAAATTTAC
 
. : . : . : . : . : . :
JMFF022J20- CGGTGGAGCCCCGAGAACCCACAGAAGCCGGAGCTGCAGGAGTACGAGATTGATCTGAAG
JMFF002F14- CGGTGGAGCCCCGAGAACCCACAGAAGCCGGAGCTGCAGGAGTACGAGATTGATCTGAAG
                      ____________________________________________________________
consensus CGGTGGAGCCCCGAGAACCCACAGAAGCCGGAGCTGCAGGAGTACGAGATTGATCTGAAG
 
. : . : . : . : . : . :
JMFF022J20- GAGTGTGGGCCGATGGTGCTGGACGCTCTGATCAAGATAAAGAACGAGATCGACCCGACG
JMFF002F14- GAGTGTGGGCCGATGGTGCTGGACGCTCTGATCAAGATAAAGAACGAGATCGACCCGACG
                      ____________________________________________________________
consensus GAGTGTGGGCCGATGGTGCTGGACGCTCTGATCAAGATAAAGAACGAGATCGACCCGACG
 
. : . : . : . : . : . :
JMFF022J20- CTGACTTTCCGGCGGTCGTGCCGGGAGGGCATCTGCGGGTCGTGCGCGATGAACATCGAC
JMFF002F14- CTGACTTTCCGGCGGTCGTGCCGGGAGGGCATCTGCGGGTCGTGCGCGATGAACATCGAC
rJMFF002F14+ CGGTCGTGCCGGGAGGGCATCTGCGGGTCGTGCGCGATGAACATCGAC
                      ____________________________________________________________
consensus CTGACTTTCCGGCGGTCGTGCCGGGAGGGCATCTGCGGGTCGTGCGCGATGAACATCGAC
 
. : . : . : . : . : . :
JMFF022J20- GGC-AAGAATGGGCTGGCCTGCCTGACGAAGATCTCGTCGGGGCCGGACTCGATGGTAAC
JMFF002F14- GGC-AAGAATGGGCTGGCCTGCCTGACGAAGATCTCGTCGGGGCCGGACTCGATGGTAAC
rJMFF002F14+ GGCAAAGAATGGGCTGGCCTGCCTGACGAAGATCTCGTCGGGGCCGGACTCGATGGTAAC
                      ____________________________________________________________
consensus GGC-AAGAATGGGCTGGCCTGCCTGACGAAGATCTCGTCGGGGCCGGACTCGATGGTAAC
 
. : . : . : . : . : . :
JMFF022J20- GCCGCTCCCACACATGTTCGTGATCAAGGATCTGGTGGTGGACATGACCAACTTCTACAA
JMFF002F14- GCCGCTCCCACACATGTTCGTGATCAAGGATCTGGTGGTGGACATGACCAACTTCTACAA
rJMFF002F14+ GCCGCTCCCACACATGTTCGTGATCAAGGATCTGGTGGTGGACATGACCAACTTCTACAA
                      ____________________________________________________________
consensus GCCGCTCCCACACATGTTCGTGATCAAGGATCTGGTGGTGGACATGACCAACTTCTACAA
 
. : . : . : . : . : . :
JMFF022J20- CCA
JMFF002F14- -CCAGTACAAGTCCATAGAGCCATGGCTGAAGCGAAAGAACCCGCCGCCGATCCCCGGCA
rJMFF002F14+ CCCAGTACAAGTCCATAGAGCCATGGCTGAAGCGAAAGAACCCGCCGCCGATCCCCGGCA
                      ____________________________________________________________
consensus CCCAGTACAAGTCCATAGAGCCATGGCTGAAGCGAAAGAACCCGCCGCCGATCCCCGGCA
 
. : . : . : . : . : . :
JMFF002F14- AGGAGGTCCTCCAGAGCAAAGCCGATAGATCTAAGCTCGACGGCATGTACGAGTGCATTC
rJMFF022J20+ CAGAGCAAANCCGATAGATCTAAGCTCGACGGCATGTACGAGTGCATTC
rJMFF002F14+ AGGAGGTCCTCCAGAGCAAAGCCGATAGATCTAAGCTCGACGGCATGTACGAGTGCATTC
                      ____________________________________________________________
consensus AGGAGGTCCTCCAGAGCAAAGCCGATAGATCTAAGCTCGACGGCATGTACGAGTGCATTC
 
. : . : . : . : . : . :
JMFF002F14- TCTGCGCCTGTTGTAGCACATCCTGCCCTAG
rJMFF022J20+ TCTGCGCCTGTTGTAGCACATCCTGCCCTAGTTACTGGTGGAACCCTGAGTCTTATCTTG
rJMFF002F14+ TCTGCGCCTGTTGTAGCACATCCTGCCCTAGTTACTGGTGGAACCCTGAGTCTTATCTTG
                      ____________________________________________________________
consensus TCTGCGCCTGTTGTAGCACATCCTGCCCTAGTTACTGGTGGAACCCTGAGTCTTATCTTG
 
. : . : . : . : . : . :
rJMFF022J20+ GCCCCGCCGCTCTCCTCCATGCCAACCGATGGATAATGGACAGCCGTGATGAATACACCA
rJMFF002F14+ GCCCCGCCGCTCTCCTCCATGCCAACCGATGGATAATGGACAGCCGTGATGAATACACCA
                      ____________________________________________________________
consensus GCCCCGCCGCTCTCCTCCATGCCAACCGATGGATAATGGACAGCCGTGATGAATACACCA
 
. : . : . : . : . : . :
rJMFF022J20+ AGGAGCGTCTGGAGGCAGTTGATCACGAGTTCAAACTTTATCGCTGCCATACAATCTTGA
rJMFF002F14+ AGGAGCGTCTGGAGGCAGTTGATCACGAGTTCAAACTTTATCGCTGCCATACAATCTTGA
                      ____________________________________________________________
consensus AGGAGCGTCTGGAGGCAGTTGATCACGAGTTCAAACTTTATCGCTGCCATACAATCTTGA
 
. : . : . : . : . : . :
rJMFF022J20+ ACTGCGCCAAAGCTTGCCCAAAGGGATTGAATCCCGGGAAGCAAATCCAGAACATCAAGG
rJMFF002F14+ ACTGCGCCAAAGCTTGCCCAAAGGGATTGAATCCCGGGAAGCAAATCCAGAACATCAAGG
                      ____________________________________________________________
consensus ACTGCGCCAAAGCTTGCCCAAAGGGATTGAATCCCGGGAAGCAAATCCAGAACATCAAGG
 
. : . : . : . : . : . :
rJMFF022J20+ CACTAGAGGTTAACAG
rJMFF002F14+ CACTAGAGGTTAACAGGCGGTTCGTATGAGTGTGCGATGATGTTTACCATTCGAAGGAGG
                      ____________________________________________________________
consensus CACTAGAGGTTAACAGGCGGTTCGTATGAGTGTGCGATGATGTTTACCATTCGAAGGAGG
 
. : . : . : . : . : . :
rJMFF002F14+ TTCCATTGGATAGAAATAATGTGTGCTTGCCATTTTAATGTGCAAATTTTCCGTACAAAC
                      ____________________________________________________________
consensus TTCCATTGGATAGAAATAATGTGTGCTTGCCATTTTAATGTGCAAATTTTCCGTACAAAC
 
. : . : . : . : . : . :
rJMFF002F14+ AATGTACTTGACCTTTAGATCAAAGGTCCTTGGTTTTTCAATTTTCCTCAATTCACTTTT
                      ____________________________________________________________
consensus AATGTACTTGACCTTTAGATCAAAGGTCCTTGGTTTTTCAATTTTCCTCAATTCACTTTT
 
. : . : . : . : . : . :
rJMFF002F14+ GTAGGTTGTCTTCTTCCTTGTAAACTGTTTTATTAGTTCATTATCCTCCTTAATACAAGC
                      ____________________________________________________________
consensus GTAGGTTGTCTTCTTCCTTGTAAACTGTTTTATTAGTTCATTATCCTCCTTAATACAAGC