Previous Contig 008210:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002B24Sequence456001265 (2)708008210 (3)gb:AP003379_18288124e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF026M24Sequence507001265 (2)762008210 (3)gb:AP003379_18288123e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF047G18Sequence371004824 (2)pir|T47737|T477371e-19hypothetical protein F18O21.160 - Arabidopsis thaliana>gb:ATF18O21_1549210 Arabi345008210 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026M24+ CTGGCTTGGGCGAAGAATCCTGCATTTGGTCATCAATAAGGGTTTGCAAAAGA
                      ____________________________________________________________
consensus CTGGCTTGGGCGAAGAATCCTGCATTTGGTCATCAATAAGGGTTTGCAAAAGA
 
. : . : . : . : . : . :
rJMFF026M24+ GAGTATACACATTAATCCTTTCCGTTTCAGGTTTTTTACCATTAAGGGTTGTATTGCTTG
                      ____________________________________________________________
consensus GAGTATACACATTAATCCTTTCCGTTTCAGGTTTTTTACCATTAAGGGTTGTATTGCTTG
 
. : . : . : . : . : . :
rJMFF026M24+ GTTTATCTGTTCTGTGTACACCAGGAGGATTAGTCTATGAAATTCTTGCTTTCTTGGGGT
                      ____________________________________________________________
consensus GTTTATCTGTTCTGTGTACACCAGGAGGATTAGTCTATGAAATTCTTGCTTTCTTGGGGT
 
. : . : . : . : . : . :
rJMFF026M24+ TTCTTTCCCTTTTATGTTGTGCGGGGGTTGGCATATGCACACTTGTGTACTTTCCTGTTG
rJMFF002B24+ TATGTTGTGCGGGGGTTGGCATATGCACACTTGTGTACTTTCCTGTTG
                      ____________________________________________________________
consensus TTCTTTCCCTTTTATGTTGTGCGGGGGTTGGCATATGCACACTTGTGTACTTTCCTGTTG
 
. : . : . : . : . : . :
rJMFF026M24+ CCGATTCTTTAGCTTTGAGGAAACTACAGAGAGATATAGAGGCTAGGCAAAGGGTGAGTG
rJMFF002B24+ CCGATTCTTTAGCTTTGAGGAAACTACAGAGAGATATAGAGGCTAGGCAAAGGGTGAGTG
                      ____________________________________________________________
consensus CCGATTCTTTAGCTTTGAGGAAACTACAGAGAGATATAGAGGCTAGGCAAAGGGTGAGTG
 
. : . : . : . : . : . :
rJMFF026M24+ ATGATCAACATAACGACACCATTTCTCTAATTGCTAACCAAAGCCTTCCTGGAGGAAGTA
rJMFF002B24+ ATGATCAACATAACGACACCATTTCTCTAATTGCTAACCAAAGCCTTCCTGGAGGAAGTA
                      ____________________________________________________________
consensus ATGATCAACATAACGACACCATTTCTCTAATTGCTAACCAAAGCCTTCCTGGAGGAAGTA
 
. : . : . : . : . : . :
rJMFF026M24+ TTGCAACTAGTCCCGGCAGAAACTCAGCAGCTTCAACAAAGCGAGGATCAATTTCTTTTC
rJMFF002B24+ TTGCAACTAGTCCCGGCAGAAACTCAGCAGCTTCAACAAAGCGAGGATCAATTTCTTTTC
                      ____________________________________________________________
consensus TTGCAACTAGTCCCGGCAGAAACTCAGCAGCTTCAACAAAGCGAGGATCAATTTCTTTTC
 
. : . : . : . : . : . :
rJMFF026M24+ GGACAATGGATAAAGATGACACTTCCGGGGCCTTTGTGGAGCTCAGCCTCTTCTCTCCAA
rJMFF002B24+ GGACAATGGATAAAGATGACACTTCCGGGGCCTTTGTGGAGCTCAGCCTCTTCTCTCCAA
                      ____________________________________________________________
consensus GGACAATGGATAAAGATGACACTTCCGGGGCCTTTGTGGAGCTCAGCCTCTTCTCTCCAA
 
. : . : . : . : . : . :
rJMFF026M24+ GTCAGCATTCGAGCCCTCCCGACTCACCTCAACTTCTTGGCTGGCCAATGCTCCCACCTG
rJMFF047G18+ AGCCCTCCCGACTCACCTCAACTTCTTGGCTGGCCAATGCTCCCACCTG
rJMFF002B24+ GTCAGCATTCGAGCCCTCCCGACTCACCTCAACTTCTTGGCTGGCCAATGCTCCCACCTG
                      ____________________________________________________________
consensus GTCAGCATTCGAGCCCTCCCGACTCACCTCAACTTCTTGGCTGGCCAATGCTCCCACCTG
 
. : . : . : . : . : . :
rJMFF026M24+ CAAAAAGAGTTCCTGTTTCCTGATAGCTGCAGAGTTAAAAAGAAGAGTCTTGGTGAACCC
rJMFF047G18+ CAAAAAGAGTTCCTGTTTCCTGATAGCTGCAGAGTTAAAAAGAAGAGTCTTGGTGAACCC
rJMFF002B24+ CAAAAAGAGTTCCTGTTTCCTGATAGCTGCAGAGTTAAAAAGAAGAGTCTTGGTGAACCC
                      ____________________________________________________________
consensus CAAAAAGAGTTCCTGTTTCCTGATAGCTGCAGAGTTAAAAAGAAGAGTCTTGGTGAACCC
 
. : . : . : . : . : . :
rJMFF026M24+ CATTTTTGTGGTGAAGAAACTCTGTAAAGATTTTTAGCTTTTATAATAAGTACTGCTCTT
rJMFF047G18+ CATTTTTGTGGTGAAGAAACTCTGTAAAGATTTTTAGCTTTTATAATAAGTACTGCTCTT
rJMFF002B24+ CATTTTTGTGGTGAAGAAACTCTGTAAAGATTTTTAGCTTTTATAATAAGTACTGCTCTT
                      ____________________________________________________________
consensus CATTTTTGTGGTGAAGAAACTCTGTAAAGATTTTTAGCTTTTATAATAAGTACTGCTCTT
 
. : . : . : . : . : . :
rJMFF026M24+ TTTTAGTTTTCACTTTTTAAAAATGTTATGATGATTTGACTGCTGTCCACCTTATTTTTT
rJMFF047G18+ TTTTAGTTTTCACTTTTTAAAAATGTTATGATGATTTGACTGCTGTCCACCTTATTTTTT
rJMFF002B24+ TTTTAGTTTTCACTTTTTAAAAATGTTATGATGATTTGACTGCTGTCCACCTTATTTTTT
                      ____________________________________________________________
consensus TTTTAGTTTTCACTTTTTAAAAATGTTATGATGATTTGACTGCTGTCCACCTTATTTTTT
 
. : . : . : . : . : . :
rJMFF026M24+ TGGTGGAATTCTTGATCTATGAGCTGCTGTATCTTTTA
rJMFF047G18+ TGGTGGAATTCTTGATCTATGAGCTGCTGTATCTTTTATGTTTTCTTCCAGTTCAATACT
rJMFF002B24+ TGGTGGAATTCTTGATCTATGAGCTGCTGTATCTTTTATGTTTTCTTCCAGTTCAATACT
                      ____________________________________________________________
consensus TGGTGGAATTCTTGATCTATGAGCTGCTGTATCTTTTATGTTTTCTTCCAGTTCAATACT
 
. : . : . : . : . : . :
rJMFF047G18+ TTTCTACAAATTTATTGATGCTTGAGAGATAAGAAATACACCTTTTCAAGTCCGAG
rJMFF002B24+ TTTCTACAAATTTATTGATGCTTGAGAGATAAGAAATACACCTTTTCAAGTCCGAGAAAT
                      ____________________________________________________________
consensus TTTCTACAAATTTATTGATGCTTGAGAGATAAGAAATACACCTTTTCAAGTCCGAGAAAT
 
. : . : . : . : . : . :
rJMFF002B24+ TTATGGCTGGGTGGTAACTTTCATTACTCAGCTTTCAAGTGTCAGACCGTACTTATGGCT
                      ____________________________________________________________
consensus TTATGGCTGGGTGGTAACTTTCATTACTCAGCTTTCAAGTGTCAGACCGTACTTATGGCT