Previous Contig 008208:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002B18Sequence726008208 (7)gb:BT010894_16408403e-55Arabidopsis thaliana At1g10500 mRNA, complete cds.>gb:BT011763_1641285 Arabidops
JMSF023L06Sequence645008208 (7)gb:BT010894_16408403e-55Arabidopsis thaliana At1g10500 mRNA, complete cds.>gb:BT011763_1641285 Arabidops690008208 (7)gb:BT010894_16408403e-55Arabidopsis thaliana At1g10500 mRNA, complete cds.>gb:BT011763_1641285 Arabidops
JMSF041E01Sequence190008208 (7)147008208 (7)
JMSF048H10Sequence672008208 (7)gb:BT010894_16408403e-55Arabidopsis thaliana At1g10500 mRNA, complete cds.>gb:BT011763_1641285 Arabidops682008208 (7)gb:BT010894_16408403e-55Arabidopsis thaliana At1g10500 mRNA, complete cds.>gb:BT011763_1641285 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023L06- GAGCTCATTTCTTGGTGGAAGTCTCCCAGGTGTCTCCTGAACAATGGC
JMSF048H10- GCTCATTTCTTGGTGGAAGTCTCCCAGGTGTCTCCTGAACAATGGC
rJMSF048H10+ GCTCATTTCTTGGTGGAAGTCTCCCAGGTGTCTCCTGAACAATGGC
rJMSF023L06+ GCTCATTTCTTGGTGGAAGTCTCCCAGGTGTCTCCTGAACAATGGC
                      ____________________________________________________________
consensus GAGCTCATTTCTTGGTGGAAGTCTCCCAGGTGTCTCCTGAACAATGGC
 
. : . : . : . : . : . :
JMSF023L06- CTTCTCTGCAGCATTCCGTTGCCCCTCTTCACCTTCTCTTTTCCGCTCGCCAAAGATCTC
JMSF048H10- CTTCTCTGCAGCATTCCGTTGCCCCTCTTCACCTTCTCTTTTCCGCTCGCCAAAGATCTC
rJMSF048H10+ CTTCTCTGCAGCATTCCGTTGCCCCTCTTCACCTTCTCTTTTCCGCTCGCCAAAGATCTC
rJMSF023L06+ CTTCTCTGCAGCATTCCGTTGCCCCTCTTCACCTTCTCTTTTCCGCTCGCCAAAGATCTC
                      ____________________________________________________________
consensus CTTCTCTGCAGCATTCCGTTGCCCCTCTTCACCTTCTCTTTTCCGCTCGCCAAAGATCTC
 
. : . : . : . : . : . :
JMSF023L06- TGCAATTTCTAGCTCTCATCTGCCGCCATCTTCAATCTGTTTTAGGTCCTCTCCTTCAAG
JMSF048H10- TGCAATTTCTAGCTCTCATCTGCCGCCATCTTCAATCTGTTTTAGGTCCTCTCCTTCAAG
rJMSF048H10+ TGCAATTTCTAGCTCTCATCTGCCGCCATCTTCAATCTGTTTTAGGTCCTCTCCTTCAAG
rJMSF023L06+ TGCAATTTCTAGCTCTCATCTGCCGCCATCTTCAATCTGTTTTAGGTCCTCTCCTTCAAG
rJMFF002B18+ TTCAAG
                      ____________________________________________________________
consensus TGCAATTTCTAGCTCTCATCTGCCGCCATCTTCAATCTGTTTTAGGTCCTCTCCTTCAAG
 
. : . : . : . : . : . :
JMSF023L06- TATCAATCGCCAGAAATTCCCCTCTATTCCATTGGCTTCGGTCCAAGCACCACCAGCAGC
JMSF048H10- TATCAATCGCCAGAAATTCCCCTCTATTCCATTGGCTTCGGTCCAAGCACCACCAGCAGC
rJMSF048H10+ TATCAATCGCCAGAAATTCCCCTCTATTCCATTGGCTTCGGTCCAAGCACCACCAGCAGC
rJMSF023L06+ TATCAATCGCCAGAAATTCCCCTCTATTCCATTGGCTTCGGTCCAAGCACCACCAGCAGC
rJMFF002B18+ TATCAATCGCCAGAAATTCCCNTCTATTCCATTGGCTTCGGTCCAAGCACCACCAGCAGC
                      ____________________________________________________________
consensus TATCAATCGCCAGAAATTCCCCTCTATTCCATTGGCTTCGGTCCAAGCACCACCAGCAGC
 
. : . : . : . : . : . :
JMSF023L06- TGGAGAAGTTGCTCCTGCGATTTCCTTGACAGACAATGCTCTGAAACACCTGAATAAGAT
JMSF048H10- TGGAGAAGTTGCTCCTGCGATTTCCTTGACAGACAATGCTCTGAAACACCTGAATAAGAT
rJMSF048H10+ TGGAGAAGTTGCTCCTGCGATTTCCTTGACAGACAATGCTCTGAAACACCTGAATAAGAT
rJMSF023L06+ TGGAGAAGTTGCTCCTGCGATTTCCTTGACAGACAATGCTCTGAAACACCTGAATAAGAT
rJMFF002B18+ TGGAGAAGTTGCTCCTGCGATTTCCTTGACAGACAATGCTCTGAAACACCTGAATAAGAT
                      ____________________________________________________________
consensus TGGAGAAGTTGCTCCTGCGATTTCCTTGACAGACAATGCTCTGAAACACCTGAATAAGAT
 
. : . : . : . : . : . :
JMSF023L06- GAGAGCTGATCGGAATGAAGATTTGTTTCTCAGGATTGGTGTCAAGCAAGGAGGATGCTC
JMSF048H10- GAGAGCTGATCGGAATGAAGATTTGTTTCTCAGGATTGGTGTCAAGCAAGGAGGATGCTC
rJMSF048H10+ GAGAGCTGATCGGAATGAAGATTTGTTTCTCAGGATTGGTGTCAAGCAAGGAGGATGCTC
rJMSF023L06+ GAGAGCTGATCGGAATGAAGATTTGTTTCTCAGGATTGGTGTCAAGCAAGGAGGATGCTC
rJMFF002B18+ GAGAGCTGATCGGAATGAAGATTTGTTTCTCAGGATTGGTGTCAAGCAAGGAGGATGCTC
                      ____________________________________________________________
consensus GAGAGCTGATCGGAATGAAGATTTGTTTCTCAGGATTGGTGTCAAGCAAGGAGGATGCTC
 
. : . : . : . : . : . :
JMSF023L06- TGGTATGTCTTATACAATGGAGTTTGAGAGCAGAGAAAATGCTAGACCAGATGATTCTGT
JMSF048H10- TGGTATGTCTTATACAATGGAGTTTGAGAGCAGAGAAAATGCTAGACCAGATGATTCTGT
rJMSF048H10+ TGGTATGTCTTATACAATGGAGTTTGAGAGCAGAGAAAATGCTAGACCAGATGATTCTGT
rJMSF023L06+ TGGTATGTCTTATACAATGGAGTTTGAGAGCAGAGAAAATGCTAGACCAGATGATTCTGT
rJMFF002B18+ TGGTATGTCTTATACAATGGAGTTTGAGAGCAGAGAAAATGCTAGACCAGATGATTCTGT
                      ____________________________________________________________
consensus TGGTATGTCTTATACAATGGAGTTTGAGAGCAGAGAAAATGCTAGACCAGATGATTCTGT
 
. : . : . : . : . : . :
JMSF023L06- CATTGAGTACAATGGCTTTGTGATTGTTTGTGATCCAAAAAGCCTTCTCTTCCTCTTTGG
JMSF048H10- CATTGAGTACAATGGCTTTGTGATTGTTTGTGATCCAAAAAGCCTTCTCTTCCTCTTTGG
rJMSF048H10+ CATTGAGTACAATGGCTTTGTGATTGTTTGTGATCCAAAAAGCCTTCTCTTCCTCTTTGG
rJMSF023L06+ CATTGAGTACAATGGCTTTGTGATTGTTTGTGATCCAAAAAGCCTTCTCTTCCTCTTTGG
rJMFF002B18+ CATTGAGTACAATGGCTTTGTGATTGTTTGTGATCCAAAAAGCCTTCTCTTCCTCTTTGG
                      ____________________________________________________________
consensus CATTGAGTACAATGGCTTTGTGATTGTTTGTGATCCAAAAAGCCTTCTCTTCCTCTTTGG
 
. : . : . : . : . : . :
JMSF023L06- GATGCAGCTGGACTACAGTGATGCACTCATAGGTGGAGGATTCTCTTTCAAGAATCCCAA
JMSF048H10- GATGCAGCTGGACTACAGTGATGCACTCATAGGTGGAGGATTCTCTTTCAAGAATCCCAA
rJMSF048H10+ GATGCAGCTGGACTACAGTGATGCACTCATAGGTGGAGGATTCTCTTTCAAGAATCCCAA
rJMSF023L06+ GATGCAGCTGGACTACAGTGATGCACTCATAGGTGGAGGATTCTCTTTCAAGAATCCCAA
rJMFF002B18+ GATGCAGCTGGACTACAGTGATGCACTCATAGGTGGAGGATTCTCTTTCAAGAATCCCAA
                      ____________________________________________________________
consensus GATGCAGCTGGACTACAGTGATGCACTCATAGGTGGAGGATTCTCTTTCAAGAATCCCAA
 
. : . : . : . : . : . :
JMSF023L06- CGCCACACAAACCTGTGGATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
JMSF048H10- CGCCACACAAACCTGTGGATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
rJMSF048H10+ CGCCACACAAACCTGTGGATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
rJMSF023L06+ CGCCACACAAACCTGTGGATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
rJMSF041E01+ GATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
JMSF041E01- GATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
rJMFF002B18+ CGCCACACAAACCTGTGGATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
                      ____________________________________________________________
consensus CGCCACACAAACCTGTGGATGTGGTAAATCATTTGCAGCGGAAATGTGATGACATGCACG
 
. : . : . : . : . : . :
JMSF023L06- CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTG
JMSF048H10- CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTGCAA
rJMSF048H10+ CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTGCAA
rJMSF023L06+ CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTGCAA
rJMSF041E01+ CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTGCAA
JMSF041E01- CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTGCAA
rJMFF002B18+ CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATAGTTTCTTGCAA
                      ____________________________________________________________
consensus CTGAATTAATATACTTACACTGGTAGTTCGGATTATAACAATAGATATTGTTTCTTGCAA
 
. : . : . : . : . : . :
JMSF048H10- TTCGCACAATCCGGTAATGCAGTA
rJMSF048H10+ TTCGCACAATCCGGTAATGCAGTATATGAAAATG
rJMSF023L06+ TTCGCACAATCCGGTAATGCAGTATATGAAAATG
rJMSF041E01+ TTCGCACAATCCGGTAATGCAGTATATGAAAATG
JMSF041E01- TTCGCACAATCCGGTAATGCAGTATATGAAAATGTGAAGACATTGTTTTTATTAATCAAT
rJMFF002B18+ TTCGCACAATCCGGTAATGCAGTATATAAAAATGTGAAGACATTGTTTTTATTAATCAAT
                      ____________________________________________________________
consensus TTCGCACAATCCGGTAATGCAGTATATGAAAATGTGAAGACATTGTTTTTATTAATCAAT
 
. : . : . : . : . : . :
JMSF041E01- ATGCTACAGTATTTGGTA
rJMFF002B18+ ATGCTACAGTATTTGGTAGTTTGTGGGATGCACGCATCTGATCTCGTAAAATATGAAAAT
                      ____________________________________________________________
consensus ATGCTACAGTATTTGGTAGTTTGTGGGATGCACGCATCTGATCTCGTAAAATATGAAAAT
 
. : . : . : . : . : . :
rJMFF002B18+ AGATATTCACATGGTAGATGGAGTGTCAAGATTAAAAATTTAGCTTTTGAGTTTTGAGTA
                      ____________________________________________________________
consensus AGATATTCACATGGTAGATGGAGTGTCAAGATTAAAAATTTAGCTTTTGAGTTTTGAGTA
 
. : . : . : . : . : . :
rJMFF002B18+ TGGACAAGGGGAAATGGAAGAGTATTGGTAACTACAACAGTAAAATTTTATATAAGAGGT
                      ____________________________________________________________
consensus TGGACAAGGGGAAATGGAAGAGTATTGGTAACTACAACAGTAAAATTTTATATAAGAGGT