Previous Contig 008199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N11Sequence570002199 (6)gb:AF130423_17708049e-85Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L729008199 (7)gb:AF130423_17708045e-17Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMFF034D21Sequence566002199 (6)gb:AF130423_17708046e-84Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L546008199 (7)gb:AF130423_17708042e-15Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMFF039J11Sequence594003743 (5)gb:AF130423_1770804e-110Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L681008199 (7)gb:AF130423_17708049e-20Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMFF045M01Sequence605003743 (5)gb:AY508971_1610257e-116Pisum sativum cultivar Torsdag mutant cryptochrome 1-1 protein (cry1-1) mRNA, co587008199 (7)gb:AY508971_16102574e-08Pisum sativum cultivar Torsdag mutant cryptochrome 1-1 protein (cry1-1) mRNA, co
JMFF051G12Sequence590002199 (6)gb:AF130423_17708045e-69Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L498008199 (7)gb:AF130423_17708041e-12Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMSF021I15Sequence670002199 (6)gb:AF130423_17708048e-92Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L813008199 (7)gb:AF130423_17708043e-32Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L
JMSF022E02Sequence672002199 (6)gb:AF130423_17708049e-92Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L758008199 (7)gb:AF130423_17708044e-28Lycopersicon esculentum cryptochrome 1 mRNA, complete cds.>gb:AF130424_1770805 L

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021I15+ CCTCAAGACATGCAAATGGAGACGAACCACGAACCAGTTAGGA
                      ____________________________________________________________
consensus CCTCAAGACATGCAAATGGAGACGAACCACGAACCAGTTAGGA
 
. : . : . : . : . : . :
rJMSF022E02+ ATCCTGCCACTATCCGGGCTGATGAAGACCAGATGGTTCCCAGCATTA
rJMSF021I15+ ACAACAACAACAATCCTGCCACTATCCGGGCTGATGAAGACCAGATGGTTCCCAGCATTA
                      ____________________________________________________________
consensus ACAACAACAACAATCCTGCCACTATCCGGGCTGATGAAGACCAGATGGTTCCCAGCATTA
 
. : . : . : . : . : . :
rJMSF022E02+ CTTCCTTTTTCAGGGACGAAGAAGAGAGCTCGATGGACCTCACAAA-CCCGGGCGTGGAT
rJMFF039J11+ TTTCAGGGACGAAGAAGAGAGCTCGATGGACCTCACAAACCCCGGGCGTGGAT
rJMSF021I15+ CTTCCTTTTTCAGGGACGAAGAAGAGAGCTCGATGGACCTCACAAA-CCCGGGCGTGGAT
rJMFF001N11+ GGGCGTGGAT
                      ____________________________________________________________
consensus CTTCCTTTTTCAGGGACGAAGAAGAGAGCTCGATGGACCTCACAAA-CCCGGGCGTGGAT
 
. : . : . : . : . : . :
rJMSF022E02+ AGCAGAGCCCAAGTGCCAATAACTGCAGCTCAAATGAGGAACAATACAGGCCAAACTGTT
rJMFF039J11+ AGCAGAGCCCAAGTGCCAATAACTGCAGCTCAAATGAGGAACAATACAGGCCAAACTGTT
rJMSF021I15+ AGCAGAGCCCAAGTGCCAATAACTGCAGCTCAAATGAGGAACAATACAGGCCAAACTGTT
rJMFF001N11+ AGCAGAGCCCAAGTGCCAATAACTGCAGCTCAAATGAGGAACAATACAGGCCAAACTGTT
                      ____________________________________________________________
consensus AGCAGAGCCCAAGTGCCAATAACTGCAGCTCAAATGAGGAACAATACAGGCCAAACTGTT
 
. : . : . : . : . : . :
rJMSF022E02+ ATCCAAGCAGCTCGAAACATCAACACCAACGCCCCGCCACAACCTAATATACGCAGAAGG
rJMFF039J11+ ATCCAAGCAGCTCGAAACATCAACACCAACGCCCCGCCACAACCTAATATACGCAGAAGG
rJMSF021I15+ ATCCAAGCAGCTCGAAACATCAACACCAACGCCCCGCCACAACCTAATATACGCAGAAGG
rJMFF045M01+ TATACGCAGAAGG
rJMFF001N11+ ATCCAAGCAGCTCGAAACATCAACACCAACGCCCCGCCACAACCTAATATACGCAGAAGG
                      ____________________________________________________________
consensus ATCCAAGCAGCTCGAAACATCAACACCAACGCCCCGCCACAACCTAATATACGCAGAAGG
 
. : . : . : . : . : . :
rJMSF022E02+ AATTCTGAAGACTCCACTGCTGATTCTTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
rJMFF039J11+ AATTCTGAAGACTCCACTGCTGATTCTTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
rJMFF051G12+ TCGTCCCAGTATGG
rJMSF021I15+ AATTCTGAAGACTCCACTGCTGATTCTTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
rJMFF045M01+ AATTCTGAAGACTCCACTGCTGATTCTTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
rJMFF034D21+ TTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
rJMFF001N11+ AATTCTGAAGACTCCACTGCTGATTCTTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
                      ____________________________________________________________
consensus AATTCTGAAGACTCCACTGCTGATTCTTCCAACAGCAGCCGGGGCGTCGTCCCAGTATGG
 
. : . : . : . : . : . :
rJMSF022E02+ TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCA-CCATTGG
rJMFF039J11+ TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCA-CCATTGG
rJMFF051G12+ TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCA-CCATTGG
rJMSF021I15+ TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCA-CCATTGG
rJMFF045M01+ TCCCCCTCGAGCACGAATTACTCGGATCAATAT-CTGGCGATGACAACACCA-CCATTGG
rJMFF034D21+ TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCA-CCATTGG
rJMFF001N11+ TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCACCCATTGG
                      ____________________________________________________________
consensus TCCCCCTCGAGCACGAATTACTCGGATCAATTTGCTGGCGATGACAACACCA-CCATTGG
 
. : . : . : . : . : . :
rJMSF022E02+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
rJMFF039J11+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
rJMFF051G12+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
rJMSF021I15+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
rJMFF045M01+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
rJMFF034D21+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
rJMFF001N11+ CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
                      ____________________________________________________________
consensus CACCACCAGTACCTCTTATTTGCAAAGGCATCAACAGCCTCATCAGCTAATGAACTGGCA
 
. : . : . : . : . : . :
rJMSF022E02+ ACGGTTG-CCCCAGACAG---GGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
rJMFF039J11+ ACGGTTG-CCCCAGACAG---GGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
rJMFF051G12+ ACGGTTGCCCCCAGACAG---GGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
rJMSF021I15+ ACGGTTG-CCCCAGACAG---GGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
rJMFF045M01+ ACGGTTG-CCCCAGACAGGCAGGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
rJMFF034D21+ ACGGTTG-CCCCAGACAGGCAGGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
rJMFF001N11+ ACGGTTG-CCCCAGACAGGCAGGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
                      ____________________________________________________________
consensus ACGGTTG-CCCCAGACAG---GGTGATTGGTTTACGCGTGGCACGACAAAAATCCAGGAA
 
. : . : . : . : . : . :
rJMSF022E02+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
rJMFF039J11+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
rJMFF051G12+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
rJMSF021I15+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
rJMFF045M01+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
rJMFF034D21+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
rJMFF001N11+ TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
                      ____________________________________________________________
consensus TGGGAGAATCAAGATATCGGGATAACAAGGTCATTCAGACAATGAATCTGCACGCACGCA
 
. : . : . : . : . : . :
rJMSF022E02+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
rJMFF039J11+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGCGTATA
rJMFF051G12+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
rJMSF021I15+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
rJMFF045M01+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
rJMFF034D21+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
rJMFF001N11+ GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
                      ____________________________________________________________
consensus GTGGATCATGTACTGTACTACTAAGTCTAGCCTGATCAGAACAGTCAATTTGTGTGTATA
 
. : . : . : . : . : . :
rJMSF022E02+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
rJMFF039J11+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
rJMFF051G12+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
rJMSF021I15+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
rJMFF045M01+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
rJMFF034D21+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
rJMFF001N11+ TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
                      ____________________________________________________________
consensus TTAGCGGATTGGATTGGATCAGGTGATTCTTTTTCGTGTTTCTGGTTCCTGTTGTATCAT
 
. : . : . : . : . : . :
rJMSF022E02+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
rJMFF039J11+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
rJMFF051G12+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
rJMSF021I15+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
rJMFF045M01+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
rJMFF034D21+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
rJMFF001N11+ ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
                      ____________________________________________________________
consensus ATCGTAGGGGTTCTACTGCATAGTATATATACACATTCTATAAGGCCAAATAATCATCAA
 
. : . : . : . : . : . :
rJMSF022E02+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTCTTCATTTT
rJMFF039J11+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTT
rJMFF051G12+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTC
rJMSF021I15+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTCTTCATTTT
rJMFF045M01+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTCTTCATTTTTGGCTTGATTG
rJMFF034D21+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTCTTCATTTTTGGCTTGATTG
rJMFF001N11+ GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTCTTCATTTTTGGCTTGATTG
                      ____________________________________________________________
consensus GTTGGCTGGGAGTTCCTGTAATAAACTCAGGTTTGTGCCTCTTCATTTTTGGCTTGATTG
 
. : . : . : . : . : . :
rJMFF045M01+ CATATGTTATTATGTGATCTTCTTTATCATA
rJMFF034D21+ CATATGTTATTATGTGATCTTCTTTATCATA
rJMFF001N11+ CATATGTTATTATGTGATCTTCTTTATCATACAATCATGGGGTTTATAGATTAGGAACAA
                      ____________________________________________________________
consensus CATATGTTATTATGTGATCTTCTTTATCATACAATCATGGGGTTTATAGATTAGGAACAA