Previous Contig 008188:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001K17Sequence547008188 (4)gb:AY497899_16093753e-46Lycopersicon esculentum C-repeat binding factor gene locus, complete sequence.731008188 (4)gb:AF211531_17773912e-36Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 111B (ACRE111B) mRNA, compl
JMSF023M24Sequence657008188 (4)gb:AY496155_16090912e-53Capsicum annuum DREB-like protein 1 mRNA, complete cds.756008188 (4)gb:AF211531_17773914e-44Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 111B (ACRE111B) mRNA, compl

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001K17- GTGATAATTAGTTCATAC
JMSF023M24- ATGTGATAATTAGTTCATAC
                      ____________________________________________________________
consensus ATGTGATAATTAGTTCATAC
 
. : . : . : . : . : . :
JMFF001K17- ACACTCCATCTCTATTGATTACTTTACTAAGTACCGCCGTCGTTTAAGTACCTACTACTT
JMSF023M24- ACACTCCATCTCTATTGATTACTTTACTAAGTACCGCCGTCGTTTAAGTACCTACTACTT
                      ____________________________________________________________
consensus ACACTCCATCTCTATTGATTACTTTACTAAGTACCGCCGTCGTTTAAGTACCTACTACTT
 
. : . : . : . : . : . :
JMFF001K17- CGATCTACTAGTCTCCATCACTCAAGATTGATCTATATATGGATATGGATATAGTTGGGA
JMSF023M24- CGATCTACTAGTCTCCATCACTCAAGATTGATCTATATATGGATATGGATATAGTTGGGA
                      ____________________________________________________________
consensus CGATCTACTAGTCTCCATCACTCAAGATTGATCTATATATGGATATGGATATAGTTGGGA
 
. : . : . : . : . : . :
JMFF001K17- ATTATTATTCTGGGAATTTTCTAAGTGCTGTCGCTGCGGCGTCGAGTTTTTGGTCGCCGG
JMSF023M24- ATTATTATTCTGGGAATTTTCTAAGTGCTGTCGCTGCGGCGTCGAGTTTTTGGTCGCCGG
                      ____________________________________________________________
consensus ATTATTATTCTGGGAATTTTCTAAGTGCTGTCGCTGCGGCGTCGAGTTTTTGGTCGCCGG
 
. : . : . : . : . : . :
JMFF001K17- AAATGGGTGGAGCAGTGTCTTCGCCGCTGTCGTCTTCTGATACTGGAAGTTGCAGCAGCG
JMSF023M24- AAATGGGTGGAGCAGTGTCTTCGCCGCTGTCGTCTTCTGATACTGGAAGTTGCAGCAGCG
                      ____________________________________________________________
consensus AAATGGGTGGAGCAGTGTCTTCGCCGCTGTCGTCTTCTGATACTGGAAGTTGCAGCAGCG
 
. : . : . : . : . : . :
JMFF001K17- CTGCTATGAAAGCGAATTTCTCGGATGAAGAGGTGCTGTTGGCTTCTAATAATCCGAAGA
JMSF023M24- CTGCTATGAAAGCGAATTTCTCGGATGAAGAGGTGCTGTTGGCTTCTAATAATCCGAAGA
                      ____________________________________________________________
consensus CTGCTATGAAAGCGAATTTCTCGGATGAAGAGGTGCTGTTGGCTTCTAATAATCCGAAGA
 
. : . : . : . : . : . :
JMFF001K17- AACGCGCTGGGAGGAAGAAGTTCCGGGAGACTCGACACCCGGTGTACCGGGGAGTGAGGA
JMSF023M24- AACGCGCTGGGAGGAAGAAGTTCCGGGAGACTCGACACCCGGTGTACCGGGGAGTGAGGA
                      ____________________________________________________________
consensus AACGCGCTGGGAGGAAGAAGTTCCGGGAGACTCGACACCCGGTGTACCGGGGAGTGAGGA
 
. : . : . : . : . : . :
JMFF001K17- GGAGGAACTCCGGGAAGTGGGTGTGTGAGGTGAGGGAGCCCAACAAGAAGTCCAGGATAT
JMSF023M24- GGAGGAACTCCGGGAAGTGGGTGTGTGAGGTGAGGGAGCCCAACAAGAAGTCCAGGATAT
rJMSF023M24+ CGGGAAGTGGGTGTNTGAGGTGAGGGAGCCCAACAAGAAGTCCAGGATAT
rJMFF001K17+ ATAT
                      ____________________________________________________________
consensus GGAGGAACTCCGGGAAGTGGGTGTGTGAGGTGAGGGAGCCCAACAAGAAGTCCAGGATAT
 
. : . : . : . : . : . :
JMFF001K17- GGCTGGGAACTTTCCCCACGGCTGAAATGGCGGCTAGAGCTCATGACGTGGCCGCCATCG
JMSF023M24- GGCTGGGAACTTTCCCCACGGCTGAAATGGCGGCTAGAGCTCATGACGTGGCCGCCATCG
rJMSF023M24+ GGCTGGGAACTTTCCCCACGGCTGAAATGGCGGCTAGAGCTCATGACGTGGCCGCCATCG
rJMFF001K17+ GGCTGGGAACTTTCCCCACGGCTGAAATGGCGGCTAGAGCTCATGACGTGGCCGCCATCG
                      ____________________________________________________________
consensus GGCTGGGAACTTTCCCCACGGCTGAAATGGCGGCTAGAGCTCATGACGTGGCCGCCATCG
 
. : . : . : . : . : . :
JMFF001K17- CTCTCAGAGGCCGCTCCGCTTGTCTCAACTTCGCCGACTCGGCTTGGAG
JMSF023M24- CTCTCAGAGGCCGCTCCGCTTGTCTCAACTTCGCCGACTCGGCTTGGAGACTTCCCATCC
rJMSF023M24+ CTCTCAGAGGCCGCTCCGCTTGTCTCAACTTCGCCGACTCGGCTTGGAGACTTCCCATCC
rJMFF001K17+ CTCTCAGAGGCCGCTCCGCTTGTCTCAACTTCGCCGACTCGGCTTGGAGACTTCCCATCC
                      ____________________________________________________________
consensus CTCTCAGAGGCCGCTCCGCTTGTCTCAACTTCGCCGACTCGGCTTGGAGACTTCCCATCC
 
. : . : . : . : . : . :
JMSF023M24- CGGCGTCCGCCGACCCAAAGGACATCCAGAAAGCTGCTGCGGAGGCGGCGGAGGCATTCC
rJMSF023M24+ CGGCGTCCGCCGACCCAAAGGACATCCAGAAAGCTGCTGCGGAGGCGGCGGAGGCATTCC
rJMFF001K17+ CGGCGTCCGCCGACCCAAAGGACATCCAGAAAGCTGCTGCGGAGGCGGCGGAGGCATTCC
                      ____________________________________________________________
consensus CGGCGTCCGCCGACCCAAAGGACATCCAGAAAGCTGCTGCGGAGGCGGCGGAGGCATTCC
 
. : . : . : . : . : . :
JMSF023M24- GTCCGGTGGCAGCAGCAAACCAAAACGAACGGATTAT
rJMSF023M24+ GTCCGGTGGCAGCAGCAAACCAAAACGAACGGATTATTATTGTAGAAGCTGAAGAAGAAG
rJMFF001K17+ GTCCGGTGGCAGCAGCAAACCAAAACGAACGGATTATTATTGTAGAAGCTGAAGAAGAAG
                      ____________________________________________________________
consensus GTCCGGTGGCAGCAGCAAACCAAAACGAACGGATTATTATTGTAGAAGCTGAAGAAGAAG
 
. : . : . : . : . : . :
rJMSF023M24+ AAGAAGAAGAGTGCAACAGTAGTAGGCAAGAGGAACAAGTGACGACCACCACCGAAAACG
rJMFF001K17+ AAGAAGAAGAGTGCAACAGTAGTAGGCAAGAGGAACAAGTGACGACCACCACCGAAAACG
                      ____________________________________________________________
consensus AAGAAGAAGAGTGCAACAGTAGTAGGCAAGAGGAACAAGTGACGACCACCACCGAAAACG
 
. : . : . : . : . : . :
rJMSF023M24+ TGTTCTTCATGGACGAGGATGCGCTTTTCGATATGCCCGGATTGCTTGCTGACATGGCTG
rJMFF001K17+ TGTTCTTCATGGACGAGGATGCGCTTTTCGATATGCCCGGATTGCTTGCTGACATGGCTG
                      ____________________________________________________________
consensus TGTTCTTCATGGACGAGGATGCGCTTTTCGATATGCCCGGATTGCTTGCTGACATGGCTG
 
. : . : . : . : . : . :
rJMSF023M24+ AAGCCCTGATGCTACCTCCACCTCAATGCGCAGTAGTGGACCGTACCAATGACGTGGAGC
rJMFF001K17+ AAGCCCTGATGCTACCTCCACCTCAATGCGCAGTAGTGGACCGTACCAATGACGTGGAGC
                      ____________________________________________________________
consensus AAGCCCTGATGCTACCTCCACCTCAATGCGCAGTAGTGGACCGTACCAATGACGTGGAGC
 
. : . : . : . : . : . :
rJMSF023M24+ TTGATGCTGACGTGTCACTCTGGTCTTACTCCATTTAAATAAATTCTCCCATTCCGTCGT
rJMFF001K17+ TTGATGCTGACGTGTCACTCTGGTCTTACTCCATTTAAATAAATTCTCCCATTCCGTCGT
                      ____________________________________________________________
consensus TTGATGCTGACGTGTCACTCTGGTCTTACTCCATTTAAATAAATTCTCCCATTCCGTCGT
 
. : . : . : . : . : . :
rJMSF023M24+ GGTTCCTACGTATTTATTTGCCAAATGCAAAATTAGGATGTATGTGAGTTGAATGTCGTC
rJMFF001K17+ GGTTCCTACGTATTTATTTGCCAAATGCAAAATTAGGATGTATGTGAGTTGAATGTCGTC
                      ____________________________________________________________
consensus GGTTCCTACGTATTTATTTGCCAAATGCAAAATTAGGATGTATGTGAGTTGAATGTCGTC
 
. : . : . : . : . : . :
rJMSF023M24+ CATTGTCCACTCCACCTACTAGTCTCTAGACTCTAGTTATATGAACAGGAGGGATGCCTG
rJMFF001K17+ CATTGTCCACTCCACCTACTAGTCTCTAGACTCTAGTTATATGAACAGGAGGGATGCCTG
                      ____________________________________________________________
consensus CATTGTCCACTCCACCTACTAGTCTCTAGACTCTAGTTATATGAACAGGAGGGATGCCTG
 
. : . : . : . : . : . :
rJMSF023M24+ CCTTTCAACAAAAGAAAAGCGTCCATTCCTATTCTATTCTATGTAGGATTAGCTACTACC
rJMFF001K17+ CCTTTCAACAAAAGAAAAGCGTCCATTCCTATTCTATTCTATGTAGGATTAGCTACTACC
                      ____________________________________________________________
consensus CCTTTCAACAAAAGAAAAGCGTCCATTCCTATTCTATTCTATGTAGGATTAGCTACTACC
 
. : . : . : . : . : . :
rJMSF023M24+ CGTACTTCATTTTTTGAGGTTGTACGGCTTCATTGTAAAATATCCG
rJMFF001K17+ CGTACTTCATTTTTTGAGGTTGTACGGCTTCATTGTAAAATATCCGATACCAAGGCTGAA
                      ____________________________________________________________
consensus CGTACTTCATTTTTTGAGGTTGTACGGCTTCATTGTAAAATATCCGATACCAAGGCTGAA