Previous Contig 008178:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F13Sequence500008178 (2)pir|D84899|D848993e-24hypothetical protein At2g46160 [imported] - Arabidopsis thaliana>gb:AC005397_153589008178 (2)pir|D84899|D848997e-36hypothetical protein At2g46160 [imported] - Arabidopsis thaliana>gb:AC005397_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001F13- ATTTTCACCCTTCCA
                      ____________________________________________________________
consensus ATTTTCACCCTTCCA
 
. : . : . : . : . : . :
JMFF001F13- TCATCATCATCATCTTCTTCCACTTCCAATGACAATCCCCTCTTTATACGCCGCCGCTCC
                      ____________________________________________________________
consensus TCATCATCATCATCTTCTTCCACTTCCAATGACAATCCCCTCTTTATACGCCGCCGCTCC
 
. : . : . : . : . : . :
JMFF001F13- TCCTCCTCCTCCTCCGTTAACAACCGTCAAGCCTAATTCTGCCCCCACTAACTTCACCAC
                      ____________________________________________________________
consensus TCCTCCTCCTCCTCCGTTAACAACCGTCAAGCCTAATTCTGCCCCCACTAACTTCACCAC
 
. : . : . : . : . : . :
JMFF001F13- CATCGGTCTTGGCTACGCCATCGCTATCGCCTTTGGCTTCCTCGTCCTCTTCTCCACCGT
                      ____________________________________________________________
consensus CATCGGTCTTGGCTACGCCATCGCTATCGCCTTTGGCTTCCTCGTCCTCTTCTCCACCGT
 
. : . : . : . : . : . :
JMFF001F13- CCTTCTCGCTTCCTACATCTGCTGCCGCTCCATCGCCGCCCGCCGTCGTCGCCGCCGCCT
rJMFF001F13+ CCTACATCTGCTGCCGCTCCATCGCCGCCCGCCGTCGTCGCCGCCGCCT
                      ____________________________________________________________
consensus CCTTCTCGCTTCCTACATCTGCTGCCGCTCCATCGCCGCCCGCCGTCGTCGCCGCCGCCT
 
. : . : . : . : . : . :
JMFF001F13- CGATGCGGAAGCTGGGTACCGTAATTCTCACCCGGACGACAACGGGGTGTACCTTCCGCG
rJMFF001F13+ CGATGCGGAAGCTGGGTACCGTAATTCTCACCCGGACGACAACGGGGTGTACCTTCCGCG
                      ____________________________________________________________
consensus CGATGCGGAAGCTGGGTACCGTAATTCTCACCCGGACGACAACGGGGTGTACCTTCCGCG
 
. : . : . : . : . : . :
JMFF001F13- TATAATCTTCGTGGCGGAAGACGACGAGGAAAACGACGGCGTTTCTGGGCAAAACGTGGC
rJMFF001F13+ TATAATCTTCGTGGCGGAAGACGACGAGGAAAACGACGGCGTTTCTGGGCAAAACGTGGC
                      ____________________________________________________________
consensus TATAATCTTCGTGGCGGAAGACGACGAGGAAAACGACGGCGTTTCTGGGCAAAACGTGGC
 
. : . : . : . : . : . :
JMFF001F13- CCTTGGGCTGGACCAGGCGGTGATCAACTCCTACCCGAAGCTGGTGTACTCCAAGAGGAG
rJMFF001F13+ CCTTGGGCTGGACCAGGCGGTGATCAACTCCTACCCGAAGCTGGTGTACTCCAAGAGGAG
                      ____________________________________________________________
consensus CCTTGGGCTGGACCAGGCGGTGATCAACTCCTACCCGAAGCTGGTGTACTCCAAGAGGAG
 
. : . : . : . : . : . :
JMFF001F13- CGGGAATCCGGGTGGGACCACCGGAAATGACACGTTGTGCTCCATATGTCTGTGCGAGTA
rJMFF001F13+ CGGGAATCCGGGTGGGACCACCGGAAATGACACGTTGTGCTCCATATGTCTGTGCGAGTA
                      ____________________________________________________________
consensus CGGGAATCCGGGTGGGACCACCGGAAATGACACGTTGTGCTCCATATGTCTGTGCGAGTA
 
. : . : . : . : . : . :
JMFF001F13- CAAGG
rJMFF001F13+ CAAGGATTCGGAGATGCTGAGGATGCTGCCGGATTGTAAACATTACTTTCACGTGACCTG
                      ____________________________________________________________
consensus CAAGGATTCGGAGATGCTGAGGATGCTGCCGGATTGTAAACATTACTTTCACGTGACCTG
 
. : . : . : . : . : . :
rJMFF001F13+ CGTGGACGCGTGGCTGAAGCTGAACGCGTCGTGCCCCGTGTGCCGGAACTCTCCCTTGCC
                      ____________________________________________________________
consensus CGTGGACGCGTGGCTGAAGCTGAACGCGTCGTGCCCCGTGTGCCGGAACTCTCCCTTGCC
 
. : . : . : . : . : . :
rJMFF001F13+ GACGCCGCTGTCCACGCCGTTGTCGGAGGTGGTCCCGCTTTCACACTACTCCGATGGACG
                      ____________________________________________________________
consensus GACGCCGCTGTCCACGCCGTTGTCGGAGGTGGTCCCGCTTTCACACTACTCCGATGGACG
 
. : . : . : . : . : . :
rJMFF001F13+ GCGAAGGCAATGATTATGGATTGATTTTTGGTTAGTGTAGGAGGTTGAATTATTTTTGTT
                      ____________________________________________________________
consensus GCGAAGGCAATGATTATGGATTGATTTTTGGTTAGTGTAGGAGGTTGAATTATTTTTGTT
 
. : . : . : . : . : . :
rJMFF001F13+ TTTTGAATTCACTGTGGAAATTCTTGTTATTTAGTGGTGTTAATTAAGGAGGAGATTGAT
                      ____________________________________________________________
consensus TTTTGAATTCACTGTGGAAATTCTTGTTATTTAGTGGTGTTAATTAAGGAGGAGATTGAT