Previous Contig 008172:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001E08Sequence709008172 (6)gb:AB110196_15269093e-34Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMFF013E17Sequence549008172 (6)pir|H96547|H965475e-23probable bHLH transcription factor [imported] - Arabidopsis thaliana>gb:AE005173745008172 (6)gb:AB110196_15269093e-34Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein, complete c
JMSF025F18Sequence707008172 (6)gb:AP003876_18346858e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMSF045K13Sequence768008172 (6)gb:AP003876_18346856e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11783008172 (6)gb:AY086197_15712524e-35Arabidopsis thaliana clone 22343 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025F18- TCCGCGAAGTCTGAACACCTTCACCAA
JMFF013E17- GTCGATTAATAATTTTCTTTTCTTGTCCGCGAAGTCTGAACACCTTCACCAA
JMSF045K13- GGTCGATTAATAATTTTCTTTTCTTGTCCGCGAAGTCTGAACACCTTCACCAA
                      ____________________________________________________________
consensus GGTCGATTAATAATTTTCTTTTCTTGTCCGCGAAGTCTGAACACCTTCACCAA
 
. : . : . : . : . : . :
JMSF025F18- AATTCCCGGCGGGCTACTCTCGGCGGCGCTCCCTTCTGCTCCGGCAGAAAGAATGGCAGC
JMFF013E17- AATTCCCGGCGGGCTACTCTCGGCGGCGCTCCTTTCTGCTCCGGCAGAAAGAATGGCAGC
JMSF045K13- AATTCCCGGCGGGCTACTCTCGGCGGCGCTCCTTTCTGCTCCGGCAGAAAGAATGGCAGC
rJMSF045K13+ GGCAGAAAGAATGGCAGC
                      ____________________________________________________________
consensus AATTCCCGGCGGGCTACTCTCGGCGGCGCTCCTTTCTGCTCCGGCAGAAAGAATGGCAGC
 
. : . : . : . : . : . :
JMSF025F18- TCCGGAGGTGGATGGCTCCAACTGGCTCCTGGATCTTGGGTTCGAAGACATTCCCTTACC
JMFF013E17- TCCGGAGGTGGATGGCTCCAACTGGCTCCTGGATCTTGGGTTCGAAGACATTCCCTTACC
JMSF045K13- TCCGGAGGTGGATGGCTCCAACTGGCTCCTGGATCTTGGGTTCGAAGACATTCCCTTACC
rJMSF045K13+ TCCGGAGGTGGATGGCTCCAACTGGCTCCTGGATCTTGGGTTCGAAGACATTCCCTTACC
                      ____________________________________________________________
consensus TCCGGAGGTGGATGGCTCCAACTGGCTCCTGGATCTTGGGTTCGAAGACATTCCCTTACC
 
. : . : . : . : . : . :
JMSF025F18- TGGCGGGAAATTCCCTCCTCTTGAGCCGGGATATCAGTGGCATTCTAGTGCCATCCTCTC
JMFF013E17- TGGCGGGAAATTCCCTCCTCTTGAGCCGGGATATCAGTGGCATTCTAGTGCCATCCTCTC
JMSF045K13- TGGCGGGAAATTCCCTCCTCTTGAGCCGGGATATCAGTGGCATTCTAGTGCCATCCTCTC
rJMSF045K13+ TGGCGGGAAATTCCCTCCTCTTGAGCCGGGATATCAGTGGCATTCTAGTGCCATCCTCTC
rJMFF013E17+ GGATATCAGTGGCATTNTAGTGCCATCNTCTN
                      ____________________________________________________________
consensus TGGCGGGAAATTCCCTCCTCTTGAGCCGGGATATCAGTGGCATTCTAGTGCCATCCTCTC
 
. : . : . : . : . : . :
JMSF025F18- TCCAGCCCCTCCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
JMFF013E17- TCCAGCCCCTCCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
JMSF045K13- TCCAGCCCCTCCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
rJMSF045K13+ TCCAGCCCCTCCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
rJMFF013E17+ TCCAGCCCCTCCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
rJMFF001E08+ CCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
                      ____________________________________________________________
consensus TCCAGCCCCTCCCAGCATTCGACAAGATGAGTCATATGTAAAATTTGATGTTTCAAACGG
 
. : . : . : . : . : . :
JMSF025F18- ATGCAGCGCCAGAAAGAGGGTGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
JMFF013E17- ATGCAGCGCCAGAAAGAGGATGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
JMSF045K13- ATGCAGCGCCAGAAAGAGGATGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
rJMSF045K13+ ATGCAGCGCCAGAAAGAGGATGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
rJMFF013E17+ ATGCAGCGCCAGAAAGAGGATGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
rJMFF001E08+ ATGCAGCGCCAGAAAGAGGATGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
                      ____________________________________________________________
consensus ATGCAGCGCCAGAAAGAGGATGAAATCTGGGGCTTGCAGTGGAGCTGCTGATTCTAAAGC
 
. : . : . : . : . : . :
JMSF025F18- ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
JMFF013E17- ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
JMSF045K13- ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
rJMSF045K13+ ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
rJMFF013E17+ ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
rJMFF001E08+ ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
                      ____________________________________________________________
consensus ACAGAGGGAGAAAATGCGAAGATATAGGCTGAATGACCGGTTCCAAGAATTGAGTTGTGT
 
. : . : . : . : . : . :
JMSF025F18- GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
JMFF013E17- GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
JMSF045K13- GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
rJMSF045K13+ GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
rJMFF013E17+ GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
rJMFF001E08+ GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
                      ____________________________________________________________
consensus GATGGACCCTGGAAAGCCACCCAAAATGGATAAATCGGCCATATTGAGCGATGCTGTTAG
 
. : . : . : . : . : . :
JMSF025F18- AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
JMFF013E17- AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
JMSF045K13- AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
rJMSF045K13+ AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
rJMFF013E17+ AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
rJMFF001E08+ AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
                      ____________________________________________________________
consensus AATGGTACTTCAGCTAAGGGATGAAGCTCAGAAGCTGAAAGAATCGTTTGAGGATTTACA
 
. : . : . : . : . : . :
JMSF025F18- GGGGCAGGTTAATGAGTTAAAGGCCGAGAAAAATGAACTTAAGGACGAGAAGCAAAAGCT
JMFF013E17- GGAGCAGGTTAATGAGT
JMSF045K13- GGAGCAGGTTAATGAGTTAAAGGCCGAGAAAAATGAACTTAAGGACGAGAAGCAAAAGCT
rJMSF045K13+ GGAGCAGGTTAATGAGTTAAAGGCCGAGAAAAATGAACTTAAGGACGAGAAGCAAAAGCT
rJMFF013E17+ GGAGCAGGTTAATGAGTTAAAGGCCGAGAAAAATGAACTTAAGGACGAGAAGCAAAAGCT
rJMFF001E08+ GGAGCAGGTTAATGAGTTAAAGGCCGAGAAAAATGAACTTAAGGACGAGAAGCAAAAGCT
                      ____________________________________________________________
consensus GGAGCAGGTTAATGAGTTAAAGGCCGAGAAAAATGAACTTAAGGACGAGAAGCAAAAGCT
 
. : . : . : . : . : . :
JMSF025F18- AAAAGAAGAGAAGGACAAACTCGAGCTGCAACTGAAAGCTCTCAACTCTCGTCCTGGGTT
JMSF045K13- AAAAGAAGAGAAGGACAAACTCGAGCTGCAACTGAAAGCTCTCAACTCTCGTCCTGGGTT
rJMSF045K13+ AAAAGAAGAGAAGGACAAACTCGAGCTGCAACTGAAAGCTCTCAACTCTCGTCCTGGGTT
rJMFF013E17+ AAAAGAAGAGAAGGACAAACTCGAGCTGCAACTGAAAGCTCTCAACTCTCGTCCTGGGTT
rJMFF001E08+ AAAAGAAGAGAAGGACAAACTCGAGCTGCAACTGAAAGCTCTCAACTCTCGTCCTGGGTT
                      ____________________________________________________________
consensus AAAAGAAGAGAAGGACAAACTCGAGCTGCAACTGAAAGCTCTCAACTCTCGTCCTGGGTT
 
. : . : . : . : . : . :
JMSF025F18- TTTACCTCACCCGCCTGCAACTGCTGTTCCATTCCCCACGCCTCATCATCTTGTAGGCGG
JMSF045K13- TTTACCTCACCCGCCTGCAACTGCTGTTCCATTCCCCACGCCTCATCATCTTGTAGGCGG
rJMSF045K13+ TTTACCTCACCCGCCTGCAACTGCTGTTCCATTCCCCACGCCTCATCATCTTGTAGGCGG
rJMFF013E17+ TTTACCTCACCCGCCTGCAACTGCTGTTCCATTCCCCACGCCTCATCATCTTGTAGGCGG
rJMFF001E08+ TTTACCTCACCCGCCTGCAACTGCTGTTCCATTCCCCACGCCTCATCATCTTGTAGGCGG
                      ____________________________________________________________
consensus TTTACCTCACCCGCCTGCAACTGCTGTTCCATTCCCCACGCCTCATCATCTTGTAGGCGG
 
. : . : . : . : . : . :
JMSF025F18- CAAGCTGGTGCCTTTCGT
JMSF045K13- CAAGCTGGTGCCTTTCGTTGGCTACCCTGGAATCCCGATGTGGCAGTTTGCAGCT
rJMSF045K13+ CAAGCTGGTGCCTTTCGTTGGCTACCCTGGAATCCCGATGTGGCAGTTTGCAGCTCCTGC
rJMFF013E17+ CAAGCTGGTGCCTTTCGTTGGCTACCCTGGAATCCCGATGTGGCAGTTTGCAGCTCCTGC
rJMFF001E08+ CAAGCTGGTGCCTTTCGTTGGCTACCCTGGAATCCCGATGTGGCAGTTTGCAGCTCCTGC
                      ____________________________________________________________
consensus CAAGCTGGTGCCTTTCGTTGGCTACCCTGGAATCCCGATGTGGCAGTTTGCAGCTCCTGC
 
. : . : . : . : . : . :
rJMSF045K13+ TGTTATTGACACACCAGAAGACCATTCTCTTCCCCCAGTTGCTTAAGTTTTATTCTGTTT
rJMFF013E17+ TGTTATTGACACACCAGAAGACCATTCTCTTCCCCCAGTTGCTTAAGTTTTATTCTGTTT
rJMFF001E08+ TGTTATTGACACACCAGAAGACCATTCTCTTCCCCCAGTTGCTTAAGTTTTATTCTGTTT
                      ____________________________________________________________
consensus TGTTATTGACACACCAGAAGACCATTCTCTTCCCCCAGTTGCTTAAGTTTTATTCTGTTT
 
. : . : . : . : . : . :
rJMSF045K13+ CTTGTTTTTCGAATTTTGTGTTTCTTTTAGGTACCAAGGAAACTG
rJMFF013E17+ CTTGTTTTTCGAATTTTGTGTTTCTTTTAGGTA-CAAGGAAACTGGCACTTCTTGTGAAC
rJMFF001E08+ CTTGTTTTTCGAATTTTGTGTTTCTTTTAGGTA-CAAGGAAACTGGCACTTCTTGTGAAC
                      ____________________________________________________________
consensus CTTGTTTTTCGAATTTTGTGTTTCTTTTAGGTA-CAAGGAAACTGGCACTTCTTGTGAAC
 
. : . : . : . : . : . :
rJMFF013E17+ CTAGTTACATAGAGTATCTAGTTATAACTTGATTCTCAAGTTTTGATCAAAATA
rJMFF001E08+ CTAGTTACATAGAGTATCTAGTTATAACTTGATTCTCAAGTTTTGATCAAAATATGAAAT
                      ____________________________________________________________
consensus CTAGTTACATAGAGTATCTAGTTATAACTTGATTCTCAAGTTTTGATCAAAATATGAAAT