Previous Contig 008164:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001B17Sequence746008164 (3)gb:AK117373_18154127e-37Arabidopsis thaliana At5g54530 mRNA for unknown protein, complete cds, clone: RA
JMSF046N08Sequence758008164 (3)gb:AK117373_18154126e-37Arabidopsis thaliana At5g54530 mRNA for unknown protein, complete cds, clone: RA675008164 (3)gb:AK117373_18154126e-37Arabidopsis thaliana At5g54530 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046N08- GATGCTC
                      ____________________________________________________________
consensus GATGCTC
 
. : . : . : . : . : . :
JMSF046N08- ATACAGTCATACCTCAGCACAAAACGACGCCATTTTGAAAGTTTCTTCTATATTTTTCCC
                      ____________________________________________________________
consensus ATACAGTCATACCTCAGCACAAAACGACGCCATTTTGAAAGTTTCTTCTATATTTTTCCC
 
. : . : . : . : . : . :
JMSF046N08- CACAGGCACAGAAGCGCCTCTAAACTTCCGTTTCTAAATTCCAATGGCGCCCCTCCTCCC
rJMFF001B17+ TAAATTCCAATGGCGCCCNTCCTCCC
                      ____________________________________________________________
consensus CACAGGCACAGAAGCGCCTCTAAACTTCCGTTTCTAAATTCCAATGGCGCCCCTCCTCCC
 
. : . : . : . : . : . :
JMSF046N08- C-GGCCGGCTCCTCATCTTCTTCTCCGTCGCCGCCGCGATATTCCTATTTTGCCCTCTCC
rJMSF046N08+ CCGTCGCCGCCGCGATATTCCTATTTTGCCCTCTCC
rJMFF001B17+ CGGGCCGGCTCCTCATCTTCTTCTCCGTCGCCGCCGCGATATTCCTATTTTGCCCTCTCC
                      ____________________________________________________________
consensus CGGGCCGGCTCCTCATCTTCTTCTCCGTCGCCGCCGCGATATTCCTATTTTGCCCTCTCC
 
. : . : . : . : . : . :
JMSF046N08- GCTCGGCCGCCATCTCCATCCACGATCTCCTGAAGTCGCAGGGCTTGCCTGCCGGACTCT
rJMSF046N08+ GCTCGGCCGCCATCTCCATCCACGATCTCCTGAAGTCGCAGGGCTTGCCTGCCGGACTCT
rJMFF001B17+ GCTCGGCCGCCATCTCCATCCACGATCTCCTGAAGTCGCAGGGCTTGCCTGCCGGACTCT
                      ____________________________________________________________
consensus GCTCGGCCGCCATCTCCATCCACGATCTCCTGAAGTCGCAGGGCTTGCCTGCCGGACTCT
 
. : . : . : . : . : . :
JMSF046N08- TCCCCAAGGAAGTGAAGAACTACACGCTGTCGGAGGATGGGGTTCTGGAGGTGTTCCTCG
rJMSF046N08+ TCCCCAAGGAAGTGAAGAACTACACGCTGTCGGAGGATGGGGTTCTGGAGGTGTTCCTCG
rJMFF001B17+ TCCCCAAGGAAGTGAAGAACTACACGCTGTCGGAGGATGGGGTTCTGGAGGTGTTCCTCG
                      ____________________________________________________________
consensus TCCCCAAGGAAGTGAAGAACTACACGCTGTCGGAGGATGGGGTTCTGGAGGTGTTCCTCG
 
. : . : . : . : . : . :
JMSF046N08- ACGGCCCCTGCCTCACAAAGTTCGATACCATGGCGTTCTACGAGAGCGTGGTGAGAGCTA
rJMSF046N08+ ACGGCCCCTGCCTCACAAAGTTCGATACCATGGCGTTCTACGAGAGCGTGGTGAGAGCTA
rJMFF001B17+ ACGGCCCCTGCCTCACAAAGTTCGATACCATGGCGTTCTACGAGAGCGTGGTGAGAGCTA
                      ____________________________________________________________
consensus ACGGCCCCTGCCTCACAAAGTTCGATACCATGGCGTTCTACGAGAGCGTGGTGAGAGCTA
 
. : . : . : . : . : . :
JMSF046N08- ATCTCTCCCACGGCGGCCTCTCCGGCGTCCAAGGCTTCTCGCAGGAGGAGCTCTTCGTCT
rJMSF046N08+ ATCTCTCCCACGGCGGCCTCTCCGGCGTCCAAGGCTTCTCGCAGGAGGAGCTCTTCGTCT
rJMFF001B17+ ATCTCTCCCACGGCGGCCTCTCCGGCGTCCAAGGCTTCTCGCAGGAGGAGCTCTTCGTCT
                      ____________________________________________________________
consensus ATCTCTCCCACGGCGGCCTCTCCGGCGTCCAAGGCTTCTCGCAGGAGGAGCTCTTCGTCT
 
. : . : . : . : . : . :
JMSF046N08- GGCTGCCGGTGAAAGGAGTAATCGTCGACGATCCTGCCTCCGGCCTCATCTTCATTGATA
rJMSF046N08+ GGCTGCCGGTGAAAGGAGTAATCGTCGACGATCCTGCCTCCGGCCTCATCTTCATTGATA
rJMFF001B17+ GGCTGCCGGTGAAAGGAGTAATCGTCGACGATCCTGCCTCCGGCCTCATCTTCATTGATA
                      ____________________________________________________________
consensus GGCTGCCGGTGAAAGGAGTAATCGTCGACGATCCTGCCTCCGGCCTCATCTTCATTGATA
 
. : . : . : . : . : . :
JMSF046N08- TCGGCTTGGCTCACAAGCAGCTCTCCCTCTCGCTCTTCGAAGATCCGCCGGATTGCAAAA
rJMSF046N08+ TCGGCTTGGCTCACAAGCAGCTCTCCCTCTCGCTCTTCGAAGATCCGCCGGATTGCAAAA
rJMFF001B17+ TCGGCTTGGCTCACAAGCAGCTCTCCCTCTCGCTCTTCGAAGATCCGCCGGATTGCAAAA
                      ____________________________________________________________
consensus TCGGCTTGGCTCACAAGCAGCTCTCCCTCTCGCTCTTCGAAGATCCGCCGGATTGCAAAA
 
. : . : . : . : . : . :
JMSF046N08- ACGACGAGGTTACAGGTGTATTAGAGGAAGCTGGGGAAGAAGAAGAGAGATTCGAAGATG
rJMSF046N08+ ACGACGAGGTTACAGGTGTATTAGAGGAAGCTGGGGAAGAAGAAGAGAGATTCGAAGATG
rJMFF001B17+ ACGACGAGGTTACAGGTGTATTAGAGGAAGCTGGGGAAGAAGAAGAGAGATTCGAAGATG
                      ____________________________________________________________
consensus ACGACGAGGTTACAGGTGTATTAGAGGAAGCTGGGGAAGAAGAAGAGAGATTCGAAGATG
 
. : . : . : . : . : . :
JMSF046N08- CATAAAGAGAGAAATATATGTTTTTAAGGAATGCAACCTCGTTTGGTGTTCTTATATATC
rJMSF046N08+ CATAAAGAGAGAAATATATGTTTTTAAGGAATGCAACCTCGTTTGGTGTTCTTATATATC
rJMFF001B17+ CATAAAGAGAGAAATATATGTTTTTAAGGAATGCAACCTCGTTTGGTGTTCTTATATATC
                      ____________________________________________________________
consensus CATAAAGAGAGAAATATATGTTTTTAAGGAATGCAACCTCGTTTGGTGTTCTTATATATC
 
. : . : . : . : . : . :
JMSF046N08- ATAGTCTTATCCTAGTATATATGAGTATAACCGTGAATCTATTACTTTGATTCACGATTT
rJMSF046N08+ ATAGTCTTATCCTAGTATATATGAGTATAACCGTGAATCTATTACTTTGATTCACGATTT
rJMFF001B17+ ATAGTCTTATCCTAGTATATATGAGTATAACCGTGAATCTATTACTTTGATTCACGATTT
                      ____________________________________________________________
consensus ATAGTCTTATCCTAGTATATATGAGTATAACCGTGAATCTATTACTTTGATTCACGATTT
 
. : . : . : . : . : . :
JMSF046N08- AATCTGTGTATTTTTGAGTAATGCATGGATAA
rJMSF046N08+ AATCTGTGTATTTTTGAGTAATGCATGGATAAAATTTTAGTATTAGGTAATGTTGTATTA
rJMFF001B17+ AATCTGTGTATTTTTGAGTAATGCATGGATAAAATTTTAGTATTAGGTAATGTTGTATTA
                      ____________________________________________________________
consensus AATCTGTGTATTTTTGAGTAATGCATGGATAAAATTTTAGTATTAGGTAATGTTGTATTA
 
. : . : . : . : . : . :
rJMSF046N08+ GTTAGAAATGTAAAGATATCGGGAAC
rJMFF001B17+ GTTAGAAATGTAAAGATATCGGGAACAACAACAGTTTTCAGTTTTATTAAAAGTATTATT
                      ____________________________________________________________
consensus GTTAGAAATGTAAAGATATCGGGAACAACAACAGTTTTCAGTTTTATTAAAAGTATTATT