Previous Contig 008161:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A19Sequence461007446 (3)gb:AF467900_18024472e-66Prunus persica clone pPn31C7 hypothetical proteins, and hypothetical transcripti617008161 (3)gb:AF275345_17825285e-55Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMFF037G23Sequence576007446 (3)gb:AF467900_18024475e-84Prunus persica clone pPn31C7 hypothetical proteins, and hypothetical transcripti769008161 (3)gb:AF275345_17825287e-67Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro
JMSF041N03Sequence786007446 (3)gb:AF467900_1802447e-105Prunus persica clone pPn31C7 hypothetical proteins, and hypothetical transcripti590008161 (3)gb:AF275345_17825288e-56Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037G23+ GCAAAAGAATGATTTTCTTAATTGATGATGTTCTTGCCATGGGGGTGGGTGGNAT
                      ____________________________________________________________
consensus GCAAAAGAATGATTTTCTTAATTGATGATGTTCTTGCCATGGGGGTGGGTGGNAT
 
. : . : . : . : . : . :
rJMFF037G23+ GAGGATAGGGTTTGATATTGGTGGAGGGTCTGGAACTTTTGCAGCAAGAATGGCTGAGAG
                      ____________________________________________________________
consensus GAGGATAGGGTTTGATATTGGTGGAGGGTCTGGAACTTTTGCAGCAAGAATGGCTGAGAG
 
. : . : . : . : . : . :
rJMSF041N03+ CCCCTTTCAATGACTTCATTGC
rJMFF037G23+ GAGCTTCACTGTAGTGACTGCTACTTTGAATCTTGATGCCCCTTTCAATGACTTCATTGC
rJMFF001A19+ TTTCAATGACTTCATTGC
                      ____________________________________________________________
consensus GAGCTTCACTGTAGTGACTGCTACTTTGAATCTTGATGCCCCTTTCAATGACTTCATTGC
 
. : . : . : . : . : . :
rJMSF041N03+ TGCAAGAGGGCTTTTCCCGCTTTACTTTAGCTTAGATCATCGGTTCCCATTCTACGATAA
rJMFF037G23+ TGCAAGAGGGCTTTTCCCGCTTTACTTTAGCTTAGATCATCGGTTCCCATTCTACGATAA
rJMFF001A19+ TGCAAGAGGGCTTTTCCCGCTTTACTTTAGCTTAGATCATCGGTTCCCATTCTACGATAA
                      ____________________________________________________________
consensus TGCAAGAGGGCTTTTCCCGCTTTACTTTAGCTTAGATCATCGGTTCCCATTCTACGATAA
 
. : . : . : . : . : . :
rJMSF041N03+ TGTGTTCGATTTGGTTCACGTGGGCAATGGACTCGATGTCAATGGCCAACCCGAGAAATT
rJMFF037G23+ TGTGTTCGATTTGGTTCACGTGGGCAATGGACTCGATGTCAATGGCCAACCCGAGAAATT
rJMFF001A19+ TGTGTTCGATTTGGTTCACGTGGGCAATGGACTCGATGTCAATGGCCAACCCGAGAAATT
                      ____________________________________________________________
consensus TGTGTTCGATTTGGTTCACGTGGGCAATGGACTCGATGTCAATGGCCAACCCGAGAAATT
 
. : . : . : . : . : . :
rJMSF041N03+ GGAGTTCTTGATGTTCGACATGGATCGTGTTCTGAGGGCCGGGGGATTGTTCTGGTTGGA
rJMFF037G23+ GGAGTTCTTGATGTTCGACATGGATCGTGTTCTGAGGGCCGGGGGATTGTTCTGGTTGGA
rJMFF001A19+ GGAGTTCTTGATGTTCGACATGGATCGTGTTCTGAGGGCCGGGGGATTGTTCTGGTTGGA
                      ____________________________________________________________
consensus GGAGTTCTTGATGTTCGACATGGATCGTGTTCTGAGGGCCGGGGGATTGTTCTGGTTGGA
 
. : . : . : . : . : . :
rJMSF041N03+ TAACTTTTACTGCTCTAGTGATGACAAGAAAAAGGCCTTAACTCGGTTGATTGAGCGGTT
rJMFF037G23+ TAACTTTTACTGCTCTAGTGATGACAAGAAAAAGGCCTTAACTCGGTTGATTGAGCGGTT
rJMFF001A19+ TAACTTTTACTGCTCTAGTGATGACAAGAAAAAGGCCTTAACTCGGTTGATTGAGCGGTT
                      ____________________________________________________________
consensus TAACTTTTACTGCTCTAGTGATGACAAGAAAAAGGCCTTAACTCGGTTGATTGAGCGGTT
 
. : . : . : . : . : . :
rJMSF041N03+ TGGGTACAAGAAGTTGAAATGGGTTGTGGGTGAGAAGAACAATGGGTCGGGAAAGCCCGA
rJMFF037G23+ TGGGTACAAGAAGTTGAAATGGGTTGTGGGTGAGAAGAACAATGGGTCGGGAAAGCCCGA
rJMFF001A19+ TGGGTACAAGAAGTTGAAATGGGTTGTGGGTGAGAAGAACAATGGGTCGGGAAAGCCCGA
                      ____________________________________________________________
consensus TGGGTACAAGAAGTTGAAATGGGTTGTGGGTGAGAAGAACAATGGGTCGGGAAAGCCCGA
 
. : . : . : . : . : . :
rJMSF041N03+ GGTGTATTTGTCTGCTGTCTTGCAGAAACCTGTAAGAGCGTGATGACAATAGAAAGCCCG
rJMFF037G23+ GGTGTATTTGTCTGCTGTCTTGCAGAAACCTGTAAGAGCGTGATGACAATAGAAAGCCCG
rJMFF001A19+ GGTGTATTTGTCTGCTGTCTTGCAGAAACCTGTAAGAGCGTGATGACAATAGAAAGCCCG
                      ____________________________________________________________
consensus GGTGTATTTGTCTGCTGTCTTGCAGAAACCTGTAAGAGCGTGATGACAATAGAAAGCCCG
 
. : . : . : . : . : . :
rJMSF041N03+ GGAGTTAGAAATAGCATGGCTAGCAGGTGATGATAATTTGTTCGATTTCATATTTTTAAG
rJMFF037G23+ GGAGTTAGAAATAGCATGGCTAGCAGGTGATGATAATTTGTTCGATTTCATATTTTTAAG
rJMFF001A19+ GGAGTTAGAAATAGCATGGCTAGCAGGTGATGATAATTTGTTCGATTTCATATTTTTAAG
                      ____________________________________________________________
consensus GGAGTTAGAAATAGCATGGCTAGCAGGTGATGATAATTTGTTCGATTTCATATTTTTAAG
 
. : . : . : . : . : . :
rJMSF041N03+ ATTATTCTCATGAATTTCTTTGTAGTACATAATAAGTGATATGCAGTGTTTGTTGCTTTC
rJMFF037G23+ ATTATTCTCATGAATTTCTTTGTAGTACATAATAAGTGATATGCAGTGTTTGTTGCTTTC
rJMFF001A19+ ATTATTCTCATGAATTTCTTTGTAGTACATAATAAGTGATATGCAGTGTTTGTTGCTTTC
                      ____________________________________________________________
consensus ATTATTCTCATGAATTTCTTTGTAGTACATAATAAGTGATATGCAGTGTTTGTTGCTTTC
 
. : . : . : . : . : . :
rJMSF041N03+ AAAATCGAAACTTTTTAGGATGATGATGATGATTCTACAGTTTAGACAGTTTGAAATATC
rJMFF037G23+ AAAATCGAAACTTTTTAGGATGATGATGATGATTCTACAGTTTAGACAGTTTGAAATATC
rJMFF001A19+ AAAATCGAAACTTTTTAGGATGATGATGATGATTCTACAGTTTAGACAGTTTGAAATATC
                      ____________________________________________________________
consensus AAAATCGAAACTTTTTAGGATGATGATGATGATTCTACAGTTTAGACAGTTTGAAATATC
 
. : . : . : . : . : . :
rJMSF041N03+ TGCGATTATTGTTTCAGAAT
rJMFF037G23+ TGCGATTATTGTTTCAGAATTGTTCTATAATGGTCAAGGAATGAATAGAGCAT
rJMFF001A19+ TGCGATTATTGTTTCAGAATTGTTCTATAATGGTCAAGGAA-GAATAGAGCATGTAACAG
                      ____________________________________________________________
consensus TGCGATTATTGTTTCAGAATTGTTCTATAATGGTCAAGGAATGAATAGAGCATGTAACAG