Previous Contig 008160:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A18Sequence384000003 (4)758008160 (4)gb:AY045774_15612968e-71Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMFF003K09Sequence419000003 (4)gb:AY045774_15612962e-06Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743757008160 (4)gb:AY045774_15612961e-71Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMFF011J17Sequence468000003 (4)gb:AP004274_18396002e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P045735008160 (4)gb:AY045774_15612961e-71Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743
JMFN037C09Sequence543008160 (4)gb:AY045774_15612961e-62Arabidopsis thaliana tubby-like protein 3 mRNA, complete cds.>gb:AY074273_156743

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037C09- TCAAAGGCAAGTGGCAATTATCTAGGAAAA
                      ____________________________________________________________
consensus TCAAAGGCAAGTGGCAATTATCTAGGAAAA
 
. : . : . : . : . : . :
JMFN037C09- TTGAGGTCGAATTTTCTCGGAACCAAGTTTACAGTGTATGATGCTTCACCGCCCGTTACA
                      ____________________________________________________________
consensus TTGAGGTCGAATTTTCTCGGAACCAAGTTTACAGTGTATGATGCTTCACCGCCCGTTACA
 
. : . : . : . : . : . :
JMFN037C09- AGAGCTAAAATGGTGAGAAGTCACAATACTAGCCCGGGGGCCTTGAAACATATCTT-CCC
rJMFF011J17+ ACTAGCCCGGGGGCCTTGAAACATATTTT-CCC
rJMFF003K09+ ACTAGCCCGGGGGCCTTGAAACATATCTT-CCC
rJMFF001A18+ ACAATACTAGCCCGGGGGCCTTGAAACATATCTTCCCC
                      ____________________________________________________________
consensus AGAGCTAAAATGGTGAGAAGTCACAATACTAGCCCGGGGGCCTTGAAACATATCTT-CCC
 
. : . : . : . : . : . :
JMFN037C09- TAGAGTACCCGTTGGAAACTATGAAGTTGCTTACATTTCATATGAGTTGAATGGACTTGC
rJMFF011J17+ TAGAGTACCCGTTGGAAACTATGAAGTTGCTCACATTTCATATGAGTTGAATGGACTTGC
rJMFF003K09+ TAGAGTACCCGTTGGAAACTATGAAGTTGCTCACATTTCATATGAGTTGAATGGACTTGC
rJMFF001A18+ TAGAGTACCCGTTGGAAACTATGAAGTTGCTCACATTTCATATGAGTTGAATGGACTTGC
                      ____________________________________________________________
consensus TAGAGTACCCGTTGGAAACTATGAAGTTGCTCACATTTCATATGAGTTGAATGGACTTGC
 
. : . : . : . : . : . :
JMFN037C09- AGCCAGGGGACCACGGAAAATGCAGTGTGTTATGGATACTATCCCCGCATCTTCGATTAA
rJMFF011J17+ AGCCAGGGGACCACGGAAAATGCAGTGTGTTATGGATACTATCCCCGCATCTTCGATTAA
rJMFF003K09+ AGCCAGGGGACCACGGAAAATGCAGTGTGTTATGGATACTATCCCCGCATCTTCGATTAA
rJMFF001A18+ AGCCAGGGGACCACGGAAAATGCAGTGTGTTATGGATACTATCCCCGCATCTTCGATTAA
                      ____________________________________________________________
consensus AGCCAGGGGACCACGGAAAATGCAGTGTGTTATGGATACTATCCCCGCATCTTCGATTAA
 
. : . : . : . : . : . :
JMFN037C09- ACCGGGAGGTGTAGCTCCCACGCAGACCGACTTTCCAATTTCGAGCGGTGATTCGTTTCC
rJMFF011J17+ ACCGGGAGGTGTAGCTCCCACGCAGACCGACTTTCCAATTTCGAGCGGTGATTCGTTTCC
rJMFF003K09+ ACCGGGAGGTGTAGCTCCCACGCAGACCGACTTTCCAATTTCGAGCGGTGATTCGTTTCC
rJMFF001A18+ ACCGGGAGGTGTAGCTCCCACGCAGACCGACTTTCCAATTTCGAGCGGTGATTCGTTTCC
                      ____________________________________________________________
consensus ACCGGGAGGTGTAGCTCCCACGCAGACCGACTTTCCAATTTCGAGCGGTGATTCGTTTCC
 
. : . : . : . : . : . :
JMFN037C09- AACAATACCCTTTTTCAGATCAAAATCAATGTGCTCGGAGAAACTCCTGTCCAGATCATC
rJMFF011J17+ AACAATACCCTTTTTCAGATCAAAATCAATGTGCTCGGAGAAACTCCTGTCCAGATCATC
rJMFF003K09+ AACAATACCCTTTTTCAGATCAAAATCAATGTGCTCGGAGAAACTCCTGTCCAGATCATC
rJMFF001A18+ AACAATACCCTTTTTCAGATCAAAATCAATGTGCTCGGAGAAACTCCTGTCCAGATCATC
                      ____________________________________________________________
consensus AACAATACCCTTTTTCAGATCAAAATCAATGTGCTCGGAGAAACTCCTGTCCAGATCATC
 
. : . : . : . : . : . :
JMFN037C09- GGAGAGGCAAACGGATGGATCGCTAGTTTTAAGAAACAAGGCTCCCAGATGGCACGAGCA
rJMFF011J17+ GGAGAGGCAAACGGATGGATCGCTAGTTTTAAGAAACAAGGCTCCCAGATGGCACGAGCA
rJMFF003K09+ GGAGAGGCAAACGGATGGATCGCTAGTTTTAAGAAACAAGGCTCCCAGATGGCACGAGCA
rJMFF001A18+ GGAGAGGCAAACGGATGGATCGCTAGTTTTAAGAAACAAGGCTCCCAGATGGCACGAGCA
                      ____________________________________________________________
consensus GGAGAGGCAAACGGATGGATCGCTAGTTTTAAGAAACAAGGCTCCCAGATGGCACGAGCA
 
. : . : . : . : . : . :
JMFN037C09- GCTCCAGTGCTGGTGCCTAAACTTTCATGGACGGGTAACCGTTGCTTCGGTGAAAAACTT
rJMFF011J17+ GCTCCAGTGCTGGTGCCTAAACTTTCATGGACGGGTAACCGTTGCTTCGGTGAAAAACTT
rJMFF003K09+ GCTCCAGTGCTGGTGCCTAAACTTTCATGGACGGGTAACCGTTGCTTCGGTGAAAAACTT
rJMFF001A18+ GCTCCAGTGCTGGTGCCTAAACTTTCATGGACGGGTAACCGTTGCTTCGGTGAAAAACTT
                      ____________________________________________________________
consensus GCTCCAGTGCTGGTGCCTAAACTTTCATGGACGGGTAACCGTTGCTTCGGTGAAAAACTT
 
. : . : . : . : . : . :
JMFN037C09- TCAGTTGGTAGCTTCTCCCGAGAATGGGGTGGCG
rJMFF011J17+ TCAGTTGGTAGCTTCTCCCGAGAATGGGGTGGCGGTGCCCGAATGTGAGAAGGTCATTCT
rJMFF003K09+ TCAGTTGGTAGCTTCTCCCGAGAATGGGGTGGCGGTGCCCGAATGTGAGAAGGTCATTCT
rJMFF001A18+ TCAGTTGGTAGCTTCTCCCGAGAATGGGGTGGCGGTGCCCGAATGTGAGAAGGTCATTCT
                      ____________________________________________________________
consensus TCAGTTGGTAGCTTCTCCCGAGAATGGGGTGGCGGTGCCCGAATGTGAGAAGGTCATTCT
 
. : . : . : . : . : . :
rJMFF011J17+ ACAGTTCGGGAAAGTAGCGAAGGATGTCTTCACAATGGATTTCCGCTACCCGTTATCGCC
rJMFF003K09+ ACAGTTCGGGAAAGTAGCGAAGGATGTCTTCACAATGGATTTCCGCTACCCGTTATCGCC
rJMFF001A18+ ACAGTTCGGGAAAGTAGCGAAGGATGTCTTCACAATGGATTTCCGCTACCCGTTATCGCC
                      ____________________________________________________________
consensus ACAGTTCGGGAAAGTAGCGAAGGATGTCTTCACAATGGATTTCCGCTACCCGTTATCGCC
 
. : . : . : . : . : . :
rJMFF011J17+ ATTTCTTGCATTTGCCATCTGTCTTAGCAACTTCGACTCCAAGTTAGCTTGTGAATAACG
rJMFF003K09+ ATTTCTTGCATTTGCCATCTGTCTTAGCAACTTCGACTCCAAGTTAGCTTGTGAATAACG
rJMFF001A18+ ATTTCTTGCATTTGCCATCTGTCTTAGCAACTTCGACTCCAAGTTAGCTTGTGAATAACG
                      ____________________________________________________________
consensus ATTTCTTGCATTTGCCATCTGTCTTAGCAACTTCGACTCCAAGTTAGCTTGTGAATAACG
 
. : . : . : . : . : . :
rJMFF011J17+ AGGATTGGGAGGGGTAAAGATGAGATTGTATCACTCTGCTATTATCTTCTGCACTGGACT
rJMFF003K09+ AGGATTGGGAGGGGTAAAGATGAGATTGTATCACTCTGCTATTATCTTCTGCACTGGACT
rJMFF001A18+ AGGATTGGGAGGGGTAAAGATGAGATTGTATCACTCTGCTATTATCTTCTGCACTGGACT
                      ____________________________________________________________
consensus AGGATTGGGAGGGGTAAAGATGAGATTGTATCACTCTGCTATTATCTTCTGCACTGGACT
 
. : . : . : . : . : . :
rJMFF011J17+ TCTTAATAATGGTGGAAACTGGAAAGTAGGGTAACCTTTACTACTGTAAATTCTTCCTTG
rJMFF003K09+ TCTTAATAATGGTGGAAACTGGAAAGTAGGGTAACCTTTACTACTGTAAATTCTTCCTTG
rJMFF001A18+ TCTTAATAATGGTGGAAACTGGAAAGTAGGGTAACCTTTACTACTGTAAATTCTTCCTTG
                      ____________________________________________________________
consensus TCTTAATAATGGTGGAAACTGGAAAGTAGGGTAACCTTTACTACTGTAAATTCTTCCTTG
 
. : . : . : . : . : . :
rJMFF011J17+ TATATATACTCTGCTCCCCTTTTTCTT
rJMFF003K09+ TATATATACTCTGCTCCCCTTTTTCTTTGAAGTTGTGAAGATAATTTTCGGTTTCGCCAC
rJMFF001A18+ TATATATACTCTGCTCCCCTTTTTC-TTGAAGTTG-GAAGATAA-TTTCGGTTTCGCCAC
                      ____________________________________________________________
consensus TATATATACTCTGCTCCCCTTTTTCTTTGAAGTTGTGAAGATAATTTTCGGTTTCGCCAC