Previous Contig 008156:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012A14Sequence556008156 (7)gb:AB061249_15220102e-79Solanum tuberosum StRPT4a mRNA for 26S proteasome AAA-ATPase subunit RPT4a, comp749008156 (7)gb:AP004279_18396936e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055
JMSF011F12Sequence362008156 (7)gb:AB061249_15220105e-42Solanum tuberosum StRPT4a mRNA for 26S proteasome AAA-ATPase subunit RPT4a, comp761008156 (7)gb:AB061249_1522010e-118Solanum tuberosum StRPT4a mRNA for 26S proteasome AAA-ATPase subunit RPT4a, comp
JMSF038F01Sequence693008156 (7)gb:AB061249_1522010e-106Solanum tuberosum StRPT4a mRNA for 26S proteasome AAA-ATPase subunit RPT4a, comp909008156 (7)gb:AB061249_1522010e-118Solanum tuberosum StRPT4a mRNA for 26S proteasome AAA-ATPase subunit RPT4a, comp
JMSF053I13Sequence658008156 (7)gb:AE005173_8926454e-77Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC007915_153906024541gb:AB061249_1522010e-113Solanum tuberosum StRPT4a mRNA for 26S proteasome AAA-ATPase subunit RPT4a, comp

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012A14- ACTCGAA
                      ____________________________________________________________
consensus ACTCGAA
 
. : . : . : . : . : . :
rJMFF012A14- TACTTCAGGTAAGAAAAGCACACCAAGTAAACATAACATTTTATGTATCTGTCATTTTGT
                      ____________________________________________________________
consensus TACTTCAGGTAAGAAAAGCACACCAAGTAAACATAACATTTTATGTATCTGTCATTTTGT
 
. : . : . : . : . : . :
rJMFF012A14- CCTCTTTCTACTGGTGGTGTGGTGGAGGGTAGGGGGTGGGGGAGATGAAGGAGGAAATGT
                      ____________________________________________________________
consensus CCTCTTTCTACTGGTGGTGTGGTGGAGGGTAGGGGGTGGGGGAGATGAAGGAGGAAATGT
 
. : . : . : . : . : . :
rJMFF012A14- TTGGGGGAGCATTGAGTTAGAATAAATCCATAAATTATCAGTATGCAAGAAGATATCCAG
                      ____________________________________________________________
consensus TTGGGGGAGCATTGAGTTAGAATAAATCCATAAATTATCAGTATGCAAGAAGATATCCAG
 
. : . : . : . : . : . :
rJMFF012A14- CAAAATCTAGTGAAAGTGCCACGTATAGAAACATGATTTGCTACACGTACATCCATGGAT
                      ____________________________________________________________
consensus CAAAATCTAGTGAAAGTGCCACGTATAGAAACATGATTTGCTACACGTACATCCATGGAT
 
. : . : . : . : . : . :
rJMFF012A14- CTCGAGAAGAAAAGTCGTTGATCCTAATCTTTGCCAAAATCTGCATTGTAATGTGCACTA
rJMSF011F12- TTGATCCTAATCTTTGCCAAAATCTGCATTGTAATGTGCACTA
rJMSF038F01- TTGATCCTAATCTTTGCCAAAATCTGCATTGTAATGTGCACTA
                      ____________________________________________________________
consensus CTCGAGAAGAAAAGTCGTTGATCCTAATCTTTGCCAAAATCTGCATTGTAATGTGCACTA
 
. : . : . : . : . : . :
rJMFF012A14- GATTCGAGCTTCTTAGCTTCATTCAGTTTTCGAACAGCCTTCATAAAGTCTTCATGGATA
rJMSF011F12- GATTCGAGCTTCTTAGCTTCATTCAGTTTTCGAACAGCCTTCATAAAGTCTTCATGGATA
rJMSF038F01- GATTCGAGCTTCTTAGCTTCATTCAGTTTTCGAACAGCCTTCATAAAGTCTTCATGGATA
                      ____________________________________________________________
consensus GATTCGAGCTTCTTAGCTTCATTCAGTTTTCGAACAGCCTTCATAAAGTCTTCATGGATA
 
. : . : . : . : . : . :
rJMFF012A14- ACATAATCTCTTTCAGCACGGATAGCTGACATCCCAGCCTCAGTACATACGTTACGCAGG
rJMSF011F12- ACATAATCTCTTTCAGCACGGATAGCTGACATCCCAGCCTCAGTACATACGTTACGCAGG
rJMSF038F01- ACATAATCTCTTTCAGCACGGATAGCTGACATCCCAGCCTCAGTACATACGTTACGCAGG
                      ____________________________________________________________
consensus ACATAATCTCTTTCAGCACGGATAGCTGACATCCCAGCCTCAGTACATACGTTACGCAGG
 
. : . : . : . : . : . :
rJMFF012A14- TCAGCACCATTAAACCCCTCTGCGAGCTTAACAACAGCTTCATACTCAATTTCACCGTGT
rJMSF011F12- TCAGCACCATTAAACCCCTCTGCGAGCTTAACAACAGCTTCATACTCAATTTCACCGTGT
rJMSF038F01- TCAGCACCATTAAACCCCTCTGCGAGCTTAACAACAGCTTCATACTCAATTTCACCGTGT
                      ____________________________________________________________
consensus TCAGCACCATTAAACCCCTCTGCGAGCTTAACAACAGCTTCATACTCAATTTCACCGTGT
 
. : . : . : . : . : . :
rJMFF012A14- TTGGCAATTCCAGAAGCATGAATTTTAAGAATTTCCATTCTTGACTGCTCATTTGGCAGT
rJMSF011F12- TTGGCAATTCCAGAAGCATGAATTTTAAGAATTTCCATTCTTGACTGCTCATTTGGCAGT
rJMSF038F01- TTGGCAATTCCAGAAGCATGAATTTTAAGAATTTCCATTCTTGACTGCTCATTTGGCAGT
                      ____________________________________________________________
consensus TTGGCAATTCCAGAAGCATGAATTTTAAGAATTTCCATTCTTGACTGCTCATTTGGCAGT
 
. : . : . : . : . : . :
rJMFF012A14- GGGATTTCAATCTTCCTATCTAGACGCCCAGGTCGAAGAAGTGCAGGGTCAAGAACATCA
rJMSF011F12- GGGATTTCAATCTTCCTATCTAGACGCCCAGGTCGAAGAAGTGCAGGGTCAAGAACATCA
rJMSF038F01- GGGATTTCAATCTTCCTATCTAGACGCCCAGGTCGAAGAAGTGCAGGGTCAAGAACATCA
                      ____________________________________________________________
consensus GGGATTTCAATCTTCCTATCTAGACGCCCAGGTCGAAGAAGTGCAGGGTCAAGAACATCA
 
. : . : . : . : . : . :
rJMFF012A14- GGTCGATTTGTTGCCATAATCATTTTTACCTTTCCAAGCTGATCAAATCCATCTAGCTGA
rJMSF011F12- GGTCGATTTGTTGCCATAATCATTTTTACCTTTCCAAGCTGATCAAATCCATCTAGCTGA
rJMSF038F01- GGTCGATTTGTTGCCATAATCATTTTTACCTTTCCAAGCTGATCAAATCCATCTAGCTGA
                      ____________________________________________________________
consensus GGTCGATTTGTTGCCATAATCATTTTTACCTTTCCAAGCTGATCAAATCCATCTAGCTGA
 
. : . : . : . : . : . :
rJMFF012A14- TTAAGCAACTCCATGANTGTTCTCTGAATTTCACGATCAGCACTTGTTCCCTCACTAAAA
rJMSF011F12- TTAAGCAACTCCATGAGTGTTCTCTGAATTTCACGATCAGCACTTGTTCCCTCACTAAAA
rJMSF038F01- TTAAGCAACTCCATGAGTGTTCTCTGAATTTCACGATCAGCACTTGTTCCCTCACTAAAA
                      ____________________________________________________________
consensus TTAAGCAACTCCATGAGTGTTCTCTGAATTTCACGATCAGCACTTGTTCCCTCACTAAAA
 
. : . : . : . : . : . :
rJMFF012A14- CGTCTTCCACCAATTGCATCAA
rJMSF011F12- CGTCTTCCACCAATTGCATCAATCTCATCCATAAAAATTATGCAGGGCTGGTGATCACGT
rJMSF038F01- CGTCTTCCACCAATTGCATCAATCTCATCCATAAAAATTATGCAGGGCTGGTGATCACGT
                      ____________________________________________________________
consensus CGTCTTCCACCAATTGCATCAATCTCATCCATAAAAATTATGCAGGGCTGGTGATCACGT
 
. : . : . : . : . : . :
rJMSF011F12- GCATAATTAAACATTTCCCGAATCAACCTTGCACTTTCACCAATGTATTTATCAATAATG
rJMSF038F01- GCATAATTAAACATTTCCCGAATCAACCTTGCACTTTCACCAATGTATTTATCAATAATG
JMSF038F01+ ATCAATAATG
                      ____________________________________________________________
consensus GCATAATTAAACATTTCCCGAATCAACCTTGCACTTTCACCAATGTATTTATCAATAATG
 
. : . : . : . : . : . :
rJMSF011F12- GCACTAGAAACAACCTTCAAAAAGTNGGCATCTATATTACTAGCAATAGCTCTAGCTAGC
rJMSF038F01- GCACTAGAAACAACCTTCAAAAAGTTGGCATCTATATTACTAGCAATAGCTCTAGCTAGC
JMSF038F01+ GCACTAGAAACAACCTTCAAAAAGTTGGCATCTATATTACTAGCAATAGCTCTAGCTAGC
                      ____________________________________________________________
consensus GCACTAGAAACAACCTTCAAAAAGTTGGCATCTATATTACTAGCAATAGCTCTAGCTAGC
 
. : . : . : . : . : . :
rJMSF011F12- AATGTCTTCCCAGTACCAGGAGGTCCATACAG
rJMSF038F01- AATGTCNTCCCAGTACCAGGAGGTCCATACAG
JMSF038F01+ AATGTCTTCCCAGTACCAGGAGGTCCATACAGAAGAACACCCTTTGGAGGCTTGATTCCA
                      ____________________________________________________________
consensus AATGTCTTCCCAGTACCAGGAGGTCCATACAGAAGAACACCCTTTGGAGGCTTGATTCCA
 
. : . : . : . : . : . :
JMSF038F01+ ACTCTGATGAAGAGCTCAGGATTCATTAGAGGCAACTCAATCGATTCCCTAAGTTCTCGA
JMFF012A14+ AGCTCAGGATTCATTAGAGGCAACTCAATCGATTCCCTAAGTTCTCGA
JMSF053I13+ AGCTCGGGATTCATAAGAGGCAGTTCAATAGATTCTCTAAGTTCTCGA
                      ____________________________________________________________
consensus ACTCTGATGAAGAGCTCAGGATTCATTAGAGGCAACTCAATCGATTCCCTAAGTTCTCGA
 
. : . : . : . : . : . :
JMSF038F01+ ATTTGATCTGACAAACCACCTACAGCAGAGTAGCTAATATTTCCAGGATCCTCATGGAGC
JMFF012A14+ ATTTGATCTGACAAACCACCTACAGCAGAGTAGCTAATATCTCCAGGATCCTCATGGAGC
JMSF053I13+ ATTTGATCCGATAAACCACCTACCGCAGAGTAACTAACATTTCCAGGATCCTCATGGAGC
                      ____________________________________________________________
consensus ATTTGATCTGACAAACCACCTACAGCAGAGTAGCTAATATTTCCAGGATCCTCATGGAGC
 
. : . : . : . : . : . :
JMSF038F01+ ATGTTATAAACAACAGGGTCAACCTCACGTGGGAGAGCTCGCATGATTGTCAGGGTTGTC
JMFF012A14+ ATGTTATAAACAACAGGGTCAACCTCACGTGGGAGAGCTCGCATGATTGTCAGGGTTGTC
JMSF053I13+ ATGCTATAAACAACAGGGTCAACCTCGCGTGGGAGAGCTCGCATGATTGTGAGGGTAGTC
                      ____________________________________________________________
consensus ATGTTATAAACAACAGGGTCAACCTCACGTGGGAGAGCTCGCATGATTGTCAGGGTTGTC
 
. : . : . : . : . : . :
JMSF038F01+ ATGTCAAGGACCACTCTTGTTCCAGCAGTCAATTTTTCCTTATCAAGTTTATTACGGCAG
JMFF012A14+ ATGTCAAGGACCACTCTTGTTCCAGCAGTCAATTTTTCCTTATCAAGTTTATTACGGCAG
JMSF011F12+ CAGCAGTCAATTTTTCCTTATCAAGTTTATTACGGCAG
JMSF053I13+ ATGTCGAGGACCACCCTAGTTCCAGCAATCAATTTTTCCTTGTCAAGTTTATTTCGGCAG
                      ____________________________________________________________
consensus ATGTCAAGGACCACTCTTGTTCCAGCAGTCAATTTTTCCTTATCAAGTTTATTACGGCAG
 
. : . : . : . : . : . :
JMSF038F01+ CCAACAACATACCTTGGGCCACTGCTTGCTTTGACAATCATTCGTTCATGGTCAAGAGGC
JMFF012A14+ CCAACAACATACCTTGGGCCACTGCTTGCTTTGACAATCATTCGTTCATGGTCAAGAGGC
JMSF011F12+ CCAACAACATACCTTGGGCCACTGCTTGCTTTGACAATCATTCGTTCATGGTCAAGAGGC
JMSF053I13+ CCAACAACATATCTCGGGCCACTGCTCGCTTTGACAATCATTCGTTCATGGTCAAGAGGC
                      ____________________________________________________________
consensus CCAACAACATACCTTGGGCCACTGCTTGCTTTGACAATCATTCGTTCATGGTCAAGAGGC
 
. : . : . : . : . : . :
JMSF038F01+ CTGAGAACTTCTCCGATAATCTGCCCTACGCTCTGAAGAGACTTCAAATCATCCTCTGTT
JMFF012A14+ CTGAGAACTTCTCCGATAATCTGCCCTACGCTCTGAAGAGACTTCAAATCATCCTCTGTT
JMSF011F12+ CTGAGAACTTCTCCGATAATCTGCCCTACGCTCTGAAGAGACTTCAAATCATCCTCTGTT
JMSF053I13+ CTAAGAACTTCACCAATTATCTGGCCTACACTCTGAAGAGACTTCAAATCATCCTCAGTT
                      ____________________________________________________________
consensus CTGAGAACTTCTCCGATAATCTGCCCTACGCTCTGAAGAGACTTCAAATCATCCTCTGTT
 
. : . : . : . : . : . :
JMSF038F01+ TTGTTGAAGTCCTTCTTCGCAGCTCT
JMFF012A14+ TTGTTGAAGTCCTTCTTCGCAGCTCT
JMSF011F12+ TTGTTGAAGTCCTTCTTCGCAGCTCT
JMSF053I13+ TTGTTGAAATCCTTCTTCGCAGCTCTGAAATTATCCCTAACTGTTTTAAGCCTAGCTTCG
                      ____________________________________________________________
consensus TTGTTGAAGTCCTTCTTCGCAGCTCTGAAATTATCCCTAACTGTTTTAAGCCTAGCTTCG
 
. : . : . : . : . : . :
JMSF053I13+ AGCTCTTTGTGGTGAAGGAGCTTCTTCCGGTACTCCGCCGCCGTCGCATTGCGGCGTCGA
                      ____________________________________________________________
consensus AGCTCTTTGTGGTGAAGGAGCTTCTTCCGGTACTCCGCCGCCGTCGCATTGCGGCGTCGA
 
. : . : . : . : . : . :
JMSF053I13+ ACTGCATCTTCCCCTTCTCCTTCACTCATCGCCCGAATCGGAGAGTTGATCGGAATTCAG
                      ____________________________________________________________
consensus ACTGCATCTTCCCCTTCTCCTTCACTCATCGCCCGAATCGGAGAGTTGATCGGAATTCAG
 
. : . : . : . : . : . :
JMSF053I13+ AAAGTTCAGGGAGCTGACGTGAATCGGAAAACAGAAGAAAGTATAAAAATGGCGTCTTTA
                      ____________________________________________________________
consensus AAAGTTCAGGGAGCTGACGTGAATCGGAAAACAGAAGAAAGTATAAAAATGGCGTCTTTA
 
. : . : . : . : . : . :
JMSF053I13+ CAGCGGTTGAAAGCTTTCTATAATGATGATTTGGAAGGTTGGTAGAGTTGGAGCCTTCTC
                      ____________________________________________________________
consensus CAGCGGTTGAAAGCTTTCTATAATGATGATTTGGAAGGTTGGTAGAGTTGGAGCCTTCTC