Previous Contig 008153:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS105E01Sequence621008153 (3)gb:AC002409_15307114e-54Arabidopsis thaliana chromosome 2 clone T20B5 map CIC11C08, complete sequence.>g
JMSF016M24Sequence252008153 (3)781011918 (2)gb:AC002409_15307115e-89Arabidopsis thaliana chromosome 2 clone T20B5 map CIC11C08, complete sequence.>g
JMSF053G17Sequence650008153 (3)gb:AC002409_15307113e-40Arabidopsis thaliana chromosome 2 clone T20B5 map CIC11C08, complete sequence.>g934011918 (2)gb:AC002409_15307114e-94Arabidopsis thaliana chromosome 2 clone T20B5 map CIC11C08, complete sequence.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS105E01+ GGTAGAGCACTCATCATTTGGCATCAGAT
                      ____________________________________________________________
consensus GGTAGAGCACTCATCATTTGGCATCAGAT
 
. : . : . : . : . : . :
JMFS105E01+ GTAATTGNAGACGTAGAGGATAAACTTCTACAGCCAATTCTGTTTGCGAGAGCCCTGAGC
                      ____________________________________________________________
consensus GTAATTGNAGACGTAGAGGATAAACTTCTACAGCCAATTCTGTTTGCGAGAGCCCTGAGC
 
. : . : . : . : . : . :
JMFS105E01+ TGATTACTTTTCGAGCCAATATAGGACCGCCTCCATACCATGTGTATAATTGATTCCAGA
JMSF053G17+ TCGAGCCAATATAGGACCGCCTCCATACCATGTGTATAATTGATTCCAGA
                      ____________________________________________________________
consensus TGATTACTTTTCGAGCCAATATAGGACCGCCTCCATACCATGTGTATAATTGATTCCAGA
 
. : . : . : . : . : . :
JMFS105E01+ CTTCCTGAGGAAGCAATATATAATCAGTGCCTTCTACTAGAGTATCACGGAGCTCAATTC
JMSF053G17+ CTTCCTGAGGAAGCAATATATAATCAGTGCCTTCTACTAGAGTATCACGGAGCTCAATTC
                      ____________________________________________________________
consensus CTTCCTGAGGAAGCAATATATAATCAGTGCCTTCTACTAGAGTATCACGGAGCTCAATTC
 
. : . : . : . : . : . :
JMFS105E01+ CCATCACAGAACTTTCTGATGTTGCTTCATATATAATGTCAGAATTATCAATACTTGAAG
JMSF053G17+ CCATCACAGAACTTTCTGATGTTGCTTCATATATAATGTCAGAATTATCAATACTTGAAG
                      ____________________________________________________________
consensus CCATCACAGAACTTTCTGATGTTGCTTCATATATAATGTCAGAATTATCAATACTTGAAG
 
. : . : . : . : . : . :
JMFS105E01+ GCCTTTTCAGAGCACAATACTCAGAAGCAGATCCATCATTCAAACTATTAATCTGGTTTT
JMSF053G17+ GCCTTTTCAGAGCACAATACTCAGAAGCAGATCCATCATTCAAACTATTAATCTGGTTTT
                      ____________________________________________________________
consensus GCCTTTTCAGAGCACAATACTCAGAAGCAGATCCATCATTCAAACTATTAATCTGGTTTT
 
. : . : . : . : . : . :
JMFS105E01+ GATTGACATATTCAAGCCATTCATGCCACCACCTCTGAGTGATTAAATAGAATGTATCGC
JMSF053G17+ GATTGACATATTCAAGCCATTCATGCCACCACCTCTGAGTGATTAAATAGAATGTATCGC
                      ____________________________________________________________
consensus GATTGACATATTCAAGCCATTCATGCCACCACCTCTGAGTGATTAAATAGAATGTATCGC
 
. : . : . : . : . : . :
JMFS105E01+ CTTCTTTGGTCTGAGCTTCCGCGGAGATTGAAATGTCTCTAATACACAGCTTCTCTTCCT
JMSF016M24+ TCTAATACACAGCTTCTCTTCCT
JMSF053G17+ CTTCTTTGGTCTGAGCTTCCGCGGAGATTGAAATGTCTCTAATACACAGCTTCTCTTCCT
                      ____________________________________________________________
consensus CTTCTTTGGTCTGAGCTTCCGCGGAGATTGAAATGTCTCTAATACACAGCTTCTCTTCCT
 
. : . : . : . : . : . :
JMFS105E01+ CTGGTGTCAGCTCCGATTTAACTTCCGGCATCTCCTGGAGCCGCTATCTTCCTTACCTCA
JMSF016M24+ CTGGTGTCAGCTCCGATTTAACTTCCGGCATCTCCNGGAGCCGCTATCTTCCTTACCTCA
JMSF053G17+ CTGGTGTCAGCTCCGATTTAACTTCCGGCATCTCCTGGAGCCGCTATCTTCCTTACCTCA
                      ____________________________________________________________
consensus CTGGTGTCAGCTCCGATTTAACTTCCGGCATCTCCTGGAGCCGCTATCTTCCTTACCTCA
 
. : . : . : . : . : . :
JMFS105E01+ GTGACGAGTAAATTTAGCAAAAAATAAATAAAATTCAGGGTATTTGGGACTGAAAGTTTT
JMSF016M24+ GTGACGAGTAAATTTAGCAAAAAATAAATAAAATTCAGGGTATTTGGGACTGAAAGTTTT
JMSF053G17+ GTGACGAGTAAATTTAGCAAAAAATAAATAAAATTCAGGGTATTTGGGACTGAAAGTTTT
                      ____________________________________________________________
consensus GTGACGAGTAAATTTAGCAAAAAATAAATAAAATTCAGGGTATTTGGGACTGAAAGTTTT
 
. : . : . : . : . : . :
JMFS105E01+ GGTTTCTTCACATAAATTAGGTTTCAGTACTCTACTCTCTAGTGCCTGGGGA
JMSF016M24+ GGTTTCTTCACATAAATTAGGTTTCAGTACTCTACTCTCTAGTGCCTGGGGAGAGAGAGA
JMSF053G17+ GGTTTCTTCACATAAATTAGGTTTCAGTACTCTACTCTCTAGTGCCTGGGGAGAGAGAGA
                      ____________________________________________________________
consensus GGTTTCTTCACATAAATTAGGTTTCAGTACTCTACTCTCTAGTGCCTGGGGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF016M24+ GAGACTGGAAATTTTTGCTCTAAGAAACGGATTTGGATTATTGCACAC
JMSF053G17+ GAGACTGGAAATTTTTGCTCTAAGAAACGGATTTGGATTATTGCACACATTAATAATCCC
                      ____________________________________________________________
consensus GAGACTGGAAATTTTTGCTCTAAGAAACGGATTTGGATTATTGCACACATTAATAATCCC
 
. : . : . : . : . : . :
JMSF053G17+ TTCCCTTTGCGGAAAATATAAATTTAAGAAGAAAATGCGGATGAAATCTTTGTTTGTGTC
                      ____________________________________________________________
consensus TTCCCTTTGCGGAAAATATAAATTTAAGAAGAAAATGCGGATGAAATCTTTGTTTGTGTC