Previous Contig 008151:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011F01Sequence448008151 (2)
JMSF053E11Sequence690008151 (2)869024538gb:AE016959_10238655e-63Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF053E11+ GGAATGGCAAGAGTGGTGAATGAGCCTAAG
                      ____________________________________________________________
consensus GGAATGGCAAGAGTGGTGAATGAGCCTAAG
 
. : . : . : . : . : . :
JMSF053E11+ AGTGATCCTTTTTGTGGCTAAGATCACTGGGAGAGAGCAAGAACAGAGGGAAAGTGGGTA
                      ____________________________________________________________
consensus AGTGATCCTTTTTGTGGCTAAGATCACTGGGAGAGAGCAAGAACAGAGGGAAAGTGGGTA
 
. : . : . : . : . : . :
JMSF011F01+ ACTGGTGGGCTGGTGTTG
JMSF053E11+ TGAAGAAGACTCAGATGACTTGAAGATTGTGGGTTCAAAAGGACTGGTGGGCTGGTGTTG
                      ____________________________________________________________
consensus TGAAGAAGACTCAGATGACTTGAAGATTGTGGGTTCAAAAGGACTGGTGGGCTGGTGTTG
 
. : . : . : . : . : . :
JMSF011F01+ AAGAGATGAGAGAGTTGGGGAGTGAGAAAGATCCGAGCTTTGAGCCATTCTTCTCTTATG
JMSF053E11+ AAGAGATGAGAGAGTTGGGGAGTGAGAAAGATCCGAGCTTTGAGCCATTCTTCTCTTATG
                      ____________________________________________________________
consensus AAGAGATGAGAGAGTTGGGGAGTGAGAAAGATCCGAGCTTTGAGCCATTCTTCTCTTATG
 
. : . : . : . : . : . :
JMSF011F01+ GGAAGGTGAGAGACATATTTGGTTGGGTGATTGAGATGGGTAGATGCATTCTTGAAATGG
JMSF053E11+ GGAAGGTGAGAGACATATTTGGTTGGGTGATTGAGATGGGTAGATGCATTCTTGAAATGG
                      ____________________________________________________________
consensus GGAAGGTGAGAGACATATTTGGTTGGGTGATTGAGATGGGTAGATGCATTCTTGAAATGG
 
. : . : . : . : . : . :
JMSF011F01+ GTTTGATGGGAAGAAGAGAAAGAATGAATCTTGATTCAAAGATTGGGTGAAAACTGGTTG
JMSF053E11+ GTTTGATGGGAAGAAGAGAAAGAATGAATCTTGATTCAAAGATTGGGTGAAAACTGGTTG
                      ____________________________________________________________
consensus GTTTGATGGGAAGAAGAGAAAGAATGAATCTTGATTCAAAGATTGGGTGAAAACTGGTTG
 
. : . : . : . : . : . :
JMSF011F01+ AGAGCCAGTTGGGTGAGGATTTGTTACCGGTGGGTGGTGGTGGTGGCCGGTGGCCGGTGG
JMSF053E11+ AGAGCCAGTTGGGTGAGGATTTGTTACCGGTGGGTGGTGGTGGTGGCCGGTGGCCGGTGG
                      ____________________________________________________________
consensus AGAGCCAGTTGGGTGAGGATTTGTTACCGGTGGGTGGTGGTGGTGGCCGGTGGCCGGTGG
 
. : . : . : . : . : . :
JMSF011F01+ CGGAAGTGGAAGTTAGACTAACTGATTTCTTGTCTGCTCAGAAGCTCTCTCTAATCTACA
JMSF053E11+ CGGAAGTGGAAGTTAGACTAACTGATTTCTTGTCTGCTCAGAAGCTCTCTCTAATCTACA
                      ____________________________________________________________
consensus CGGAAGTGGAAGTTAGACTAACTGATTTCTTGTCTGCTCAGAAGCTCTCTCTAATCTACA
 
. : . : . : . : . : . :
JMSF011F01+ CTGTTTCTTTCTGATGCATTTCCAAACCAAAAAATTTGAGCTTTTTGTAACTGAGAGATG
JMSF053E11+ CTGTTTCTTTCTGATGCATTTCCAAACCAAAAAATTTGAGCTTTTTGTAACTGAGAGATG
                      ____________________________________________________________
consensus CTGTTTCTTTCTGATGCATTTCCAAACCAAAAAATTTGAGCTTTTTGTAACTGAGAGATG
 
. : . : . : . : . : . :
JMSF011F01+ CCTTCAGAGAAGGTTGTTTTCGATCAGATTGGAATCCTC
JMSF053E11+ CCTTCAGAGAAGGTTGTTTTCGATCAGATTGGAATCCTCTCTTTTTTCTTTTTCTGGGGA
                      ____________________________________________________________
consensus CCTTCAGAGAAGGTTGTTTTCGATCAGATTGGAATCCTCTCTTTTTTCTTTTTCTGGGGA
 
. : . : . : . : . : . :
JMSF053E11+ TTTCTTTATATAGCTTTTGATGTGTGTTATCAACTTGGATAGTTGGATGTGCAGTTGTTT
                      ____________________________________________________________
consensus TTTCTTTATATAGCTTTTGATGTGTGTTATCAACTTGGATAGTTGGATGTGCAGTTGTTT
 
. : . : . : . : . : . :
JMSF053E11+ CTTCTTTCTGGAGTTTCGAACTTCAAATTTGGTGGCCTGCTATCAGTTTCAGAGTATGCC
                      ____________________________________________________________
consensus CTTCTTTCTGGAGTTTCGAACTTCAAATTTGGTGGCCTGCTATCAGTTTCAGAGTATGCC