Previous Contig 008149:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001O12Sequence489008149 (9)gb:AC091774_17350492e-18Oryza sativa chromosome 6 BAC OJ1540_H01 genomic sequence, complete sequence.>gb788008149 (9)gb:FSY277744_16794091e-97Fagus sylvatica mRNA for ABA and calcium induced protein phosphatase 2C (PP2C),
JMFS095A05Sequence627008149 (9)pir|T51100|T511002e-77protein phosphatase 2C homolog [imported] - common ice plant>gb:AF097667_1767893
JMSF001J12Sequence636008149 (9)gb:FSY277744_16794093e-76Fagus sylvatica mRNA for ABA and calcium induced protein phosphatase 2C (PP2C),
JMSF001K12Sequence367008149 (9)741008149 (9)gb:FSY277744_16794091e-92Fagus sylvatica mRNA for ABA and calcium induced protein phosphatase 2C (PP2C),
JMSF026F12Sequence680008149 (9)pir|T51100|T511003e-51protein phosphatase 2C homolog [imported] - common ice plant>gb:AF097667_1767893746008149 (9)gb:FSY277744_16794091e-93Fagus sylvatica mRNA for ABA and calcium induced protein phosphatase 2C (PP2C),
JMSF053C21Sequence664008149 (9)gb:AC091774_17350492e-17Oryza sativa chromosome 6 BAC OJ1540_H01 genomic sequence, complete sequence.>gb916024536gb:FSY277744_1679409e-116Fagus sylvatica mRNA for ABA and calcium induced protein phosphatase 2C (PP2C),

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001J12- TTNATGTTTTAGAAGAAGCTACAT-GTCTGCGAG
rJMSF001K12- TTTAGAAGAAGCTACAT-GTCTGCGAG
rJMSF026F12- TTTAGAAGAAGCTACATGGTCTGCGAG
                      ____________________________________________________________
consensus TTNATGTTTTAGAAGAAGCTACAT-GTCTGCGAG
 
. : . : . : . : . : . :
rJMSF001J12- TGGCTGGTACGAAAATAGTACAACAAACAAAGAAAGAATTATATATAATTAAATTTAGCA
rJMSF001K12- TGGCTGGTACGAAAATAGTACAACAAACAAAGAAAGAATTATATATAATTAAATTTAGCA
rJMSF026F12- TGGCTGGTACGAAAATAGTACAACAAACAAAGAAAGAATTATATATAATTAAATTTAGCA
                      ____________________________________________________________
consensus TGGCTGGTACGAAAATAGTACAACAAACAAAGAAAGAATTATATATAATTAAATTTAGCA
 
. : . : . : . : . : . :
rJMSF001J12- GGCAGCGCCAAATTAAAGGAGCATTACATTGCTGCGGTGGCGCATGGAGCAAGAGTGTTA
rJMSF001K12- GGCAGCGCCAAATTAAAGGAGCATTACATTGCTGCGGTGGCGCATGGAGCAAGAGTGTTA
rJMSF026F12- GGCAGCGCCAAATTAAAGGAGCATTACATTGCTGCGGTGGCGCATGGAGCAAGAGTGTTA
                      ____________________________________________________________
consensus GGCAGCGCCAAATTAAAGGAGCATTACATTGCTGCGGTGGCGCATGGAGCAAGAGTGTTA
 
. : . : . : . : . : . :
rJMSF001J12- TGGCGCAGATTCAAAGTGCCTCCCTTGACAGACAGGCTAGCAACCTTGACAGGACCAAGA
rJMSF001K12- TGGCGCAGATTCAAAGTGCCTCCCTTGACAGACAGGCTAGCAACCTTGACAGGACCAAGA
rJMSF026F12- TGGCGCAGATTCAAAGTGCCTCCCTTGACAGACAGGCTAGCAACCTTGACAGGACCAAGA
                      ____________________________________________________________
consensus TGGCGCAGATTCAAAGTGCCTCCCTTGACAGACAGGCTAGCAACCTTGACAGGACCAAGA
 
. : . : . : . : . : . :
rJMSF001J12- TTGGAGTTGAGGTATACAACCACCACTGTGATGTCATCGTGGAAATGGCGACGAACACCC
rJMSF001K12- TTGGAGTTGAGGTATACAACCACCACTGTGATGTCATCGTGGAAATGGCGACGAACACCC
rJMSF026F12- TTGGAGTTGAGGTATACAACCACCACTGTGATGTCATCGTGGAAATGGCGACGAACACCC
rJMFF001O12- TGTCATCGTGGAAATGGCGACGAACACCC
                      ____________________________________________________________
consensus TTGGAGTTGAGGTATACAACCACCACTGTGATGTCATCGTGGAAATGGCGACGAACACCC
 
. : . : . : . : . : . :
rJMSF001J12- CTGTCTATTTTCTTCAAGTCTGAGTATCTCATTTCCCTTTTCTTGGCTGCTTCTCGCAGT
rJMSF001K12- CTGTCTATTTTCTTCAAGTCTGAGTATCTCATTTCCCTTTTCTTGGCTGCTTCTCGCAGT
rJMSF026F12- CTGTCTATTTTCTTCAAGTCTGAGTATCTCATTTCCCTTTTCTTGGCTGCTTCTCGCAGT
rJMFF001O12- CTGTCTATTTTCTTCAAGTCTGAGTATCTCATTTCCCTTTTCTTGGCTGCTTCTCGCAGT
                      ____________________________________________________________
consensus CTGTCTATTTTCTTCAAGTCTGAGTATCTCATTTCCCTTTTCTTGGCTGCTTCTCGCAGT
 
. : . : . : . : . : . :
rJMSF001J12- GCAGTCTTTACTAGCCTTCTAGCAATCCCATTGCGGGGGTGATGTTGGACAATGTCAACA
rJMSF001K12- GCAGTCTTTACTAGCCTTCTAGCAATCCCATTGCGGGGGTGATGTTGGACAATGTCAACA
rJMSF026F12- GCAGTCTTTACTAGCCTTCTAGCAATCCCATTGCGGGGGTGATGTTGGACAATGTCAACA
rJMFF001O12- GCAGTCTTTACTAGCCTTCTAGCAATCCCATTGCGGGGGTGATGTTGGACAATGTCAACA
                      ____________________________________________________________
consensus GCAGTCTTTACTAGCCTTCTAGCAATCCCATTGCGGGGGTGATGTTGGACAATGTCAACA
 
. : . : . : . : . : . :
rJMSF001J12- GCTTCTTGATTACTTAGGTGCTCCCACAGACCATCTGATGCAAATATCACAAATTGATCA
rJMSF001K12- GCTTCTTGATTACTTAGGTGCTCCCACAGACCATCTGATGCAAATATCACAAATTGATCA
rJMSF026F12- GCTTCTTGATTACTTAGGTGCTCCCACAGACCATCTGATGCAAATATCACAAATTGATCA
rJMFF001O12- GCTTCTTGACTACTTAGGTGCTCCCACAGACCATCTGATGCAAATATCACAAATTGATCA
                      ____________________________________________________________
consensus GCTTCTTGATTACTTAGGTGCTCCCACAGACCATCTGATGCAAATATCACAAATTGATCA
 
. : . : . : . : . : . :
rJMSF001J12- TGAGATTGCAATTGGAGCACAGAAATGGATGGATCAGAGCTGAGTATGGGTTTTTTAAAA
rJMSF001K12- TGAGATTGCAATTGGAGCACAGAAATGGATGGATCAGAGCTGAGTATGGGTTTTTTAAAA
rJMSF026F12- TGAGATTGCAATTGGAGCACAGAAATGGATGGATCAGAGCTGAGTATGGGTTTTTTAAAA
rJMFF001O12- TGAGATTGCAATTGGAGCACAGAAATGGATGGATCAGAGCTGAGTATGGGTTTTTTAAAA
                      ____________________________________________________________
consensus TGAGATTGCAATTGGAGCACAGAAATGGATGGATCAGAGCTGAGTATGGGTTTTTTAAAA
 
. : . : . : . : . : . :
rJMSF001J12- GGTTCACGCAGCCGAAATTTTGCATATAGTGGTTCCCTGTTGAATTCTGCTTTCTTCAAG
rJMSF001K12- GGTTCACGCAGCCGAAATTTTGCATATAGTGGTTCCCTGTTGAATTCTGCTTTCTTCAAG
rJMSF026F12- GGTTCACGCAGCCGAAATTTTGCATATAGTGGTTCCCTGTTGAATTCTGCTTTCTTCAAG
rJMFF001O12- GGTTCACGCAGCCGAAATTTTGCATATAGTGGTTCCCTGTTGAATTCTGCTTTCTTCAAG
                      ____________________________________________________________
consensus GGTTCACGCAGCCGAAATTTTGCATATAGTGGTTCCCTGTTGAATTCTGCTTTCTTCAAG
 
. : . : . : . : . : . :
rJMSF001J12- TACACATCACCAATAGATCTTGTGATCTGTATAATGCCCTTGACACGCCACACATTGTGC
rJMSF001K12- TACACATCACCAATAGATCTTGTGATCTGTATAATGCCCTTGACACGCCACACATTGTGC
rJMSF026F12- TACACATCACCAATAGATCTTGTGATCTGTATAATGCCCTTGACACGCCACACATTGTGC
rJMFF001O12- TACACATCACCAATAGATCTTGTGATCTGTATAATGCCCTTGACACGCCACACATTGTGC
JMFS095A05+ CTGTATAATGCCCTTGACACGCCACACATTGTGC
                      ____________________________________________________________
consensus TACACATCACCAATAGATCTTGTGATCTGTATAATGCCCTTGACACGCCACACATTGTGC
 
. : . : . : . : . : . :
rJMSF001J12- TTT
rJMSF001K12- TTTAAAACCACAATTTGTGAGTCATCTGGGTGCAAACATTGTAGCTCCTGTCTTACAGAT
rJMSF026F12- TTTAAAACCACAATTTGTGAGTCATCTGGGTGCAAACATTGTAGCTCCTGTCTTACAGAT
rJMFF001O12- TTTAAAACCACAATTTGTGAGTCATCTGGGTGCAAACATTGTAGCTCCTGTCTTACAGAT
JMFS095A05+ TTTAAAACCACAATTTGTGAGTCATCTGGGTGCAAACATTGTAGCTCCTGTCTTACAGAT
                      ____________________________________________________________
consensus TTTAAAACCACAATTTGTGAGTCATCTGGGTGCAAACATTGTAGCTCCTGTCTTACAGAT
 
. : . : . : . : . : . :
rJMSF001K12- TCAATGCTTGCATTGTGTTCTGCCGACAGCTGTACTGCAAATACCTCCCCNGTCG
rJMSF026F12- TCAATGCTTGCATTGTGTTCTGCCGACAGCTGTACTGCAAATACCTCCCCCGTCGCCTT
rJMFF001O12- TCAATGCTTGCATTGTGTTCTGCCGACAGCTGTACTGCAAATACCTCCCCCGTCGCCTTC
JMFS095A05+ TCAATGCTTGCATTGTGTTCTGCCGACAGCTGTACTGCAAATACCTCCCCCGTCGCCTTC
                      ____________________________________________________________
consensus TCAATGCTTGCATTGTGTTCTGCCGACAGCTGTACTGCAAATACCTCCCCCGTCGCCTTC
 
. : . : . : . : . : . :
rJMFF001O12- ACAAGCCTCCCTAAAACAGCACGCGAGTCT
JMFS095A05+ ACAAGCCTCCCTAAAACAGCACGCGAGTCTCCCAGGTTGGCAATATATAGAGATCCAGAG
                      ____________________________________________________________
consensus ACAAGCCTCCCTAAAACAGCACGCGAGTCTCCCAGGTTGGCAATATATAGAGATCCAGAG
 
. : . : . : . : . : . :
JMFS095A05+ CAGATAACTCCAACAAGGCAGCATGATCCAACAGCAGCAATCTGTGGCTTCACTGCCCAT
                      ____________________________________________________________
consensus CAGATAACTCCAACAAGGCAGCATGATCCAACAGCAGCAATCTGTGGCTTCACTGCCCAT
 
. : . : . : . : . : . :
JMFS095A05+ TGTGCCGACACAACTCTGTTAAACCCCTCTTCTGTTGCTTCAAATGCCTTTCGAATTACC
JMSF026F12+ TGCTTCAAATGCCTTTCGAATTACC
                      ____________________________________________________________
consensus TGTGCCGACACAACTCTGTTAAACCCCTCTTCTGTTGCTTCAAATGCCTTTCGAATTACC
 
. : . : . : . : . : . :
JMFS095A05+ TCCACTGACATTGATTGCTGCTCAGAAACGAACCTCTTGAGGTAGTGGAACAGGTTGTCA
JMSF026F12+ TCCACTGACATTGATTGCTGCTCAGAAACGAACCTCTTGAGGTAGTGGAACAGGTTGTCA
                      ____________________________________________________________
consensus TCCACTGACATTGATTGCTGCTCAGAAACGAACCTCTTGAGGTAGTGGAACAGGTTGTCA
 
. : . : . : . : . : . :
JMFS095A05+ TTGATATACCTAGAGGTCTCAGGGCCTCCATGCCCATCATAAATTCCCACAAAGGTA
JMSF026F12+ TTGATATACCTAGAGGTCTCAGGGCCTCCATGCCCATCATAAATTCCCACAAAGGTACCA
                      ____________________________________________________________
consensus TTGATATACCTAGAGGTCTCAGGGCCTCCATGCCCATCATAAATTCCCACAAAGGTACCA
 
. : . : . : . : . : . :
JMFF001O12+ TCTTCCATC
JMSF026F12+ TATGGTCCATAGTCATATGAGCTTAAACACCCAGATTCAAGCCGACTCTGATCTTCCATC
JMSF053C21+ TCTTCCATC
                      ____________________________________________________________
consensus TATGGTCCATAGTCATATGAGCTTAAACACCCAGATTCAAGCCGACTCTGATCTTCCATC
 
. : . : . : . : . : . :
JMFF001O12+ AGGTTATTGGCTTGAACTACAGCCATTGAGAACTCTCCACTAAAATGCTGCCCTGTATCC
JMSF026F12+ AGGTTATTGGCTTGAACTACAGCCATTGAGAACTCTCCACTAAAATGCTGCCCTGTATCC
JMSF053C21+ AGGTTATTGGCTTGAACTACAGCCATTGAGAACTCTCCACTAAAATGCTGCCCTGTATCC
                      ____________________________________________________________
consensus AGGTTATTGGCTTGAACTACAGCCATTGAGAACTCTCCACTAAAATGCTGCCCTGTATCC
 
. : . : . : . : . : . :
JMFF001O12+ TTGTACCATAGGAGCCCATCTTGACGACCAGTAGCATCAGAACCCGAGTACACATGCCGT
JMSF026F12+ TTGTACCATAGGAGCCCATCTTGACGACCAGTAGCATCAGAACCCGAGTACACATGCCGT
JMSF053C21+ TTGTACCATAGGAGCCCATCTTGACGACCAGTAGCATCAGAACCCGAGTACACATGCCGT
                      ____________________________________________________________
consensus TTGTACCATAGGAGCCCATCTTGACGACCAGTAGCATCAGAACCCGAGTACACATGCCGT
 
. : . : . : . : . : . :
JMFF001O12+ TCTCCCTTTGGGCAAAAGCACGCCCTCAGAATTTTCATCAACCCAGATAACATACCTCAT
JMSF026F12+ TCTCCCTTTGGGCAAAAGCACGCCCTCAGAATTTTCATCAACCCAGATAACATACCTCAT
JMSF053C21+ TCTCCCTTTGGGCAAAAGCACGCCCTCAGAATTTTCATCAACCCAGATAACATACCTCAT
                      ____________________________________________________________
consensus TCTCCCTTTGGGCAAAAGCACGCCCTCAGAATTTTCATCAACCCAGATAACATACCTCAT
 
. : . : . : . : . : . :
JMFF001O12+ CTCATCCACACCAGCCTCCAATTGATTATCTTCTAACTTCTAAGTGACTCACTCCTCACG
JMSF026F12+ CTCATCCACACCAGCCTCCAATTGATTATCTTCTAACTTCTAAGTGACTCACTCCTCACG
JMSF053C21+ CTCATCCACACCAGCCTCCAATTGATTATCTTCTAACTTCTAAGTGACTCACTCCTCACG
                      ____________________________________________________________
consensus CTCATCCACACCAGCCTCCAATTGATTATCTTCTAACTTCTAAGTGACTCACTCCTCACG
 
. : . : . : . : . : . :
JMFF001O12+ CCCACTTATGTCAATGCTTCTCTCTGCAGAAACAACAAAAATTCCCTGCACTTTGAGAAT
JMSF026F12+ CCCACTTATGTCAATGCTTCTCTCTGCAGAAACAACAAAAATTCC-----CTTTGAGAAT
JMSF001K12+ TTTGAGAAT
JMSF053C21+ CCCACTTATGTCAATGCTTCTCTCTGCAGAAACAACAAAAATTCC-----CTTTGAGAAT
                      ____________________________________________________________
consensus CCCACTTATGTCAATGCTTCTCTCTGCAGAAACAACAAAAATTCC-----CTTTGAGAAT
 
. : . : . : . : . : . :
JMFF001O12+ GAATAGAAGATCTGAAAGCGAAAGAGCTTATAGATCTGCGGATCCTTCAAATCAAACTTT
JMSF026F12+ GAATAGAAGATCTGAAAGCGAAAGAGCTTATAGATCTGCGGATCCTTCAAATCAAACTTT
JMSF001K12+ GAATAGAAGATCTGAAAGCGAAAGAGCTTATAGATCTGCGGATCCTTCAAATCAAACTTT
JMSF053C21+ GAATAGAAGATCTGAAAGCGAAAGAGCTTATAGATCTGCGGATCCTTCAAATCAAACTTT
                      ____________________________________________________________
consensus GAATAGAAGATCTGAAAGCGAAAGAGCTTATAGATCTGCGGATCCTTCAAATCAAACTTT
 
. : . : . : . : . : . :
JMFF001O12+ GACGGTTTCTTATCTATCTTTGTGTGTTTATCTAAAGTCAAAGAAAGAATAAAAAAGACG
JMSF026F12+ GACGGTTTCTTATCTATCTTTGTGTGTTTATCTAAAGTCAAAGAAAGAATAAAAAAGACG
JMSF001K12+ GACGGTTTCTTATCTATCTTTGTGTGTTTATCTAAAGTCAAAGAAAGAATAAAAAAGACG
JMSF053C21+ GACGGTTTCTTATCTATCTTTGTGTGTTTATCTAAAGTCAAAGAAAGAATAAAAAAGACG
                      ____________________________________________________________
consensus GACGGTTTCTTATCTATCTTTGTGTGTTTATCTAAAGTCAAAGAAAGAATAAAAAAGACG
 
. : . : . : . : . : . :
JMFF001O12+ ATGGAAGAGAAATGAATGAAATCGATGAGAGTGAGCGTGTGAACTGGTTCGATTGTGCC
JMSF026F12+ ATGGAAGAGAAATGAATGAAATCGATGAGAGTGAGCGTGTGAACTGGTTCGATTGTGCC
JMSF001K12+ ATGGAAGAGAAATGAATGAAATCGATGAGAGTGAGCGTGTGAACTGGTTCGATTGTGCCA
JMSF053C21+ ATGGAAGAGAAATGAATGAAATCGATGAGAGTGAGCGTGTGAACTGGTTCGATTGTGCCA
                      ____________________________________________________________
consensus ATGGAAGAGAAATGAATGAAATCGATGAGAGTGAGCGTGTGAACTGGTTCGATTGTGCCA
 
. : . : . : . : . : . :
JMSF001K12+ ATCTCTCTCTCAACAGACAAACCCCATTAAAAATAAAAACAATGGAGAGCTTCAGGCCAG
JMSF053C21+ ATCTCTCTCTCAACAGACAAACCCCATTAAAAATAAAAACAATGGAGAGCTTCAGGCCAG
                      ____________________________________________________________
consensus ATCTCTCTCTCAACAGACAAACCCCATTAAAAATAAAAACAATGGAGAGCTTCAGGCCAG
 
. : . : . : . : . : . :
JMSF001K12+ CAAAGCAGAGGACCAGCTTGGGCTCCACAAACCTGCCTCTTCACTCCCAACCTTTTGCTA
JMSF053C21+ CAAAGCAGAGGACCAGCTTGGGCTCCACAAACCTGCCTCTTCACTCCCAACCTTTTGCTA
                      ____________________________________________________________
consensus CAAAGCAGAGGACCAGCTTGGGCTCCACAAACCTGCCTCTTCACTCCCAACCTTTTGCTA
 
. : . : . : . : . : . :
JMSF001K12+ CACAAACAAATGATCTTCAAAATCTGTACTGACAAATAACCGACGCTTCTTCGCTC
JMSF053C21+ CACAAACAAATGATCTTCAAAATCTGTACTGACAAATAACCGACGCTTCTTCGCTCGCTC
                      ____________________________________________________________
consensus CACAAACAAATGATCTTCAAAATCTGTACTGACAAATAACCGACGCTTCTTCGCTCGCTC