Previous Contig 008146:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006J12Sequence325008146 (2)407014042 (2)pir|T13462|T134621e-32hypothetical protein T19F6.130 - Arabidopsis thaliana>gb:ATAC002343_1542770 Arab
JMSF053C03Sequence687008146 (2)gb:AE016959_10235976e-19Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09831014042 (2)pir|T13462|T134622e-79hypothetical protein T19F6.130 - Arabidopsis thaliana>gb:ATAC002343_1542770 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF053C03+ TGTACAGAGTGTCCGAANCNTCTTCTA
                      ____________________________________________________________
consensus TGTACAGAGTGTCCGAANCNTCTTCTA
 
. : . : . : . : . : . :
JMSF053C03+ GCTGTAACTTGCTAGAAGAGGTGAGACACAGAATCTTGGATTCTCCTTGCTCGGAGACCA
                      ____________________________________________________________
consensus GCTGTAACTTGCTAGAAGAGGTGAGACACAGAATCTTGGATTCTCCTTGCTCGGAGACCA
 
. : . : . : . : . : . :
JMSF053C03+ AGATCGTGCCGCCGTTGGCTATGGCTTCTTTGGACGAGGAACAGTAATACGACCTCCACT
                      ____________________________________________________________
consensus AGATCGTGCCGCCGTTGGCTATGGCTTCTTTGGACGAGGAACAGTAATACGACCTCCACT
 
. : . : . : . : . : . :
JMSF053C03+ CCGCTTCAACGATGAAATCTATCACTTTGTAAGTGTAACACAGGACAAAATCCAGAATGT
                      ____________________________________________________________
consensus CCGCTTCAACGATGAAATCTATCACTTTGTAAGTGTAACACAGGACAAAATCCAGAATGT
 
. : . : . : . : . : . :
JMSF053C03+ CGAGGACGGAGAAGACGACAAAGCCAAGAACATCGTTGACAGCTCTCCCCGTCATTAGTA
                      ____________________________________________________________
consensus CGAGGACGGAGAAGACGACAAAGCCAAGAACATCGTTGACAGCTCTCCCCGTCATTAGTA
 
. : . : . : . : . : . :
JMSF006J12+ CTGAAACCGCCATTGTCGCTAGCTGCCACCCAAAATAATCAC
JMSF053C03+ GAGCCCATTTAGTTCGCTCTGAAACCGCCATTGTCGCTAGCTGCCACCCAAAATAATCAC
                      ____________________________________________________________
consensus GAGCCCATTTAGTTCGCTCTGAAACCGCCATTGTCGCTAGCTGCCACCCAAAATAATCAC
 
. : . : . : . : . : . :
JMSF006J12+ AAAAAATGAAACGTCAAGATTCACAAAGATGGACTTTTACTACCGTGATGGCACTCATTA
JMSF053C03+ AAAAAATGAAACGTCAAGATTCACAAAGATGGACTTTTACTACCGTGATGGCACTCATTA
                      ____________________________________________________________
consensus AAAAAATGAAACGTCAAGATTCACAAAGATGGACTTTTACTACCGTGATGGCACTCATTA
 
. : . : . : . : . : . :
JMSF006J12+ GGCGGATAAAAGCTAGCTCAGAGTGCCACCAAGGTAATGTCCCACGCAACAATGGTTGTC
JMSF053C03+ GGCGGATAAAAGCTAGCTCAGAGTGCCACCAAGGTAATGTCCCACGCAACAATGGTTGTC
                      ____________________________________________________________
consensus GGCGGATAAAAGCTAGCTCAGAGTGCCACCAAGGTAATGTCCCACGCAACAATGGTTGTC
 
. : . : . : . : . : . :
JMSF006J12+ TTTCTTCGTTCTCCGTTCCCCTCTCTAAAAGAAATGGAGAAAAAACAAGGGAGTATGGGC
JMSF053C03+ TTTCTTCGTTCTCCGTTCCCCTCTCTAAAAGAAATGGAGAAAAAACAAGGGAGTATGGGC
                      ____________________________________________________________
consensus TTTCTTCGTTCTCCGTTCCCCTCTCTAAAAGAAATGGAGAAAAAACAAGGGAGTATGGGC
 
. : . : . : . : . : . :
JMSF006J12+ AATGGGTATAGAATATCAGAGGCTTTCTGCAAAAGGGTAGTGGAGAAAAAGGAGGGAGAT
JMSF053C03+ AATGGGTATAGAATATCAGAGGCTTTCTGCAAAAGGGTAGTGGAGAAAAAGGAGGGAGAT
                      ____________________________________________________________
consensus AATGGGTATAGAATATCAGAGGCTTTCTGCAAAAGGGTAGTGGAGAAAAAGGAGGGAGAT
 
. : . : . : . : . : . :
JMSF006J12+ GCAATGGCAATGTGGGTGTTCAGAACTCTAGCTATGTTA
JMSF053C03+ GCAATGGCAATGTGGGTGTTCAGAACTCTAGCTATGTTAGCTTCTTCCTGAAATCTTGAC
                      ____________________________________________________________
consensus GCAATGGCAATGTGGGTGTTCAGAACTCTAGCTATGTTAGCTTCTTCCTGAAATCTTGAC
 
. : . : . : . : . : . :
JMSF053C03+ TTGCAAAGATAATATATGTACACAATTTGGTGGAGAGAAGAGAAATGGTCATGGTGGATC
                      ____________________________________________________________
consensus TTGCAAAGATAATATATGTACACAATTTGGTGGAGAGAAGAGAAATGGTCATGGTGGATC