Previous Contig 008141:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS010G07Sequence595008141 (4)
JMFS052G07Sequence629008141 (4)
JMSF023G09Sequence631008141 (4)gb:AY849914_16308029e-16Lycopersicon esculentum AvrPto-dependent Pto-interacting protein 3 (Adi3) mRNA, 810014035 (2)gb:AY849914_16308022e-77Lycopersicon esculentum AvrPto-dependent Pto-interacting protein 3 (Adi3) mRNA,
JMSF052P06Sequence735008141 (4)869014035 (2)gb:AY849914_16308021e-75Lycopersicon esculentum AvrPto-dependent Pto-interacting protein 3 (Adi3) mRNA,

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023G09+ CTCTGGCCAATTGGTA
                      ____________________________________________________________
consensus CTCTGGCCAATTGGTA
 
. : . : . : . : . : . :
JMSF023G09+ CGTACACCGGTCTCATCAGGTCTGTATCAACTGGTTCAGCCGGATGGCTGACCCCATGGA
                      ____________________________________________________________
consensus CGTACACCGGTCTCATCAGGTCTGTATCAACTGGTTCAGCCGGATGGCTGACCCCATGGA
 
. : . : . : . : . : . :
JMSF023G09+ ACGATGAAGAATTGATATCTTCATACGAATCAGCACTTGTCTTAAACGATGAACCAACAT
                      ____________________________________________________________
consensus ACGATGAAGAATTGATATCTTCATACGAATCAGCACTTGTCTTAAACGATGAACCAACAT
 
. : . : . : . : . : . :
JMSF023G09+ CAAGCATAACATCCTCTTCTGTCTCATGACAAATCATCCCTCCTCCTTTCCATGCTTGTA
                      ____________________________________________________________
consensus CAAGCATAACATCCTCTTCTGTCTCATGACAAATCATCCCTCCTCCTTTCCATGCTTGTA
 
. : . : . : . : . : . :
JMSF023G09+ GAGGAGGCCCAGTTAAGACGAGATCTTCAAACTCCTGCAAATTGGGTTTGTTCCCCACAT
JMSF052P06+ GGGTTTGTT-CCCACAT
                      ____________________________________________________________
consensus GAGGAGGCCCAGTTAAGACGAGATCTTCAAACTCCTGCAAATTGGGTTTGTTCCCCACAT
 
. : . : . : . : . : . :
JMSF023G09+ CTCGCCTTTCGAAAACTGGGCGAGTACTCATCAATTTAGCCTCAGGCCTTTCGAAAACTT
JMFS052G07+ CTCATCAATTTAGCCTCAGGCCTTTCGAAAACTT
JMSF052P06+ CTCNCNTTTCGAAAACTGGGCGAGTACTCATCAATTTAGCCTCA-GCCNTTCGAAAACTT
                      ____________________________________________________________
consensus CTCGCCTTTCGAAAACTGGGCGAGTACTCATCAATTTAGCCTCAGGCCTTTCGAAAACTT
 
. : . : . : . : . : . :
JMSF023G09+ GGTGAGTACTCATCAATTTAGTAGCCTCAGGCCTTTCAAAAACTGGGCGAGTACTCATCA
JMFS052G07+ GGTGAGTACTCATCAATTTAGTAGCTTCAGGCCTTTCAAAAACTGGGCGAGTACTCATCA
JMFS010G07+ GAGTACTCATCAATTTAGTAGCCTCAGGCCTTTCAAAAACTGGGCGAGTACTCATCA
JMSF052P06+ GGTGAGTACTCATCAATTTAGTAGCCTCAGGCCTTTCAAAAACTGGGCGAGTACTCATCA
                      ____________________________________________________________
consensus GGTGAGTACTCATCAATTTAGTAGCCTCAGGCCTTTCAAAAACTGGGCGAGTACTCATCA
 
. : . : . : . : . : . :
JMSF023G09+ ATCTAGCCTCGGGTTTGTTTCCCACATCTCGTCTTTCAAAAACTGGGTGAGTACTCATCA
JMFS052G07+ ATCTAGCCTCGGGTTTGTTTCCCACATCTCGTCTTTCAAAAACTGGGTGAGTACTCATCA
JMFS010G07+ ATCTAGCATCGGGTTTGTTTCCCACATCTCGTCTTTCAAAAACTGGGTGAGTACTCATCA
JMSF052P06+ ATCTAGCCTCGGGTTTGTTTCCCACATCTCGTCTTTCAAAAACTGGGTGAGTACTCATCA
                      ____________________________________________________________
consensus ATCTAGCCTCGGGTTTGTTTCCCACATCTCGTCTTTCAAAAACTGGGTGAGTACTCATCA
 
. : . : . : . : . : . :
JMSF023G09+ ATTTACCCTCACTAGACAACGGTGAGGGCAGAGGCGCCACCTTAGCCTCTAAAGGCTGCC
JMFS052G07+ ATTTACCCTCACTAGACAACGGTGAGGGCAGAGGCGCCACCTTAGCCTCTAAAGGCTGCC
JMFS010G07+ ATTTACCCTCACTAGACAACGGTGAGGGCAGAGGCGCCACCTTAGCCTCTAAAGGCTGCC
JMSF052P06+ ATTTACCCTCACTAGACAACGGTGAGGGCAGAGGCGCCACCTTAGCCTCTAAAGGCTGCC
                      ____________________________________________________________
consensus ATTTACCCTCACTAGACAACGGTGAGGGCAGAGGCGCCACCTTAGCCTCTAAAGGCTGCC
 
. : . : . : . : . : . :
JMSF023G09+ TTGGAACTGGTTTTGATTCTGAACCCCTTTGCATCTCTGGTTACAAAATATCATCACAAG
JMFS052G07+ TTGGAACTGGTTTTGATTCTGAACCCCTTTGCATCTCTGGTTACAAAATATCATCACAAG
JMFS010G07+ TTGGAACTGGTTTTGATTCTGAACCCCTTTGCATCTCTGGTTACAAAATATCATCACAAG
JMSF052P06+ TTGGAACTGGTTTTGATTCTGAACCCCTTTGCATCTCTGGTTACAAAATATCATCACAAG
                      ____________________________________________________________
consensus TTGGAACTGGTTTTGATTCTGAACCCCTTTGCATCTCTGGTTACAAAATATCATCACAAG
 
. : . : . : . : . : . :
JMSF023G09+ CACACCTCTGCCTGTGTGACTGCGTCTCTACTCCAGAGCACTAGAAGCCGCGATTAATGG
JMFS052G07+ CACACCTCTGCCTGTGTGACTGCGTCTCTACTCCAGAGCACTAGAAGCCGCGATTAATGG
JMFS010G07+ CACACCTCTGCCTGTGTGACTGCGTCTCTACTCCAGAGCACTAGAAGCCGCGATTAATGG
JMSF052P06+ CACACCTCTGCCTGTGTGACTGCGTCTCTACTCCAGAGCACTAGAAGCCGCGATTAATGG
                      ____________________________________________________________
consensus CACACCTCTGCCTGTGTGACTGCGTCTCTACTCCAGAGCACTAGAAGCCGCGATTAATGG
 
. : . : . : . : . : . :
JMSF023G09+ CGAGCAGGGAATAC
JMFS052G07+ CGAGCAGGGAATACGAATTTAAGCAAACACCTCTCAGGCGCAATAAATGGGGGGTTTTCA
JMFS010G07+ CGAGCAGGGAATACGAATTTAAGCAAACACCTCTCAGGCGCAATAAATGGGGGGTTTTCA
JMSF052P06+ CGAGCAGGGAATACGAATTTAAGCAAACACCTCTCAGGCGCAATAAATGGGGGGTTTTCA
                      ____________________________________________________________
consensus CGAGCAGGGAATACGAATTTAAGCAAACACCTCTCAGGCGCAATAAATGGGGGGTTTTCA
 
. : . : . : . : . : . :
JMFS052G07+ GTTTTCAGTTCTGGGAATTGAATGCTTTTTCGGCGAGACTACAACAGCTACGGCGCGCTT
JMFS010G07+ GTTTTCAGTTCTGGGAATTGAATGCTTTTTCGGCGAGACTACAACAGCTACGGCGCGCTT
JMSF052P06+ GTTTTCAGTTCTGGGAATTGAATGCTTTTTCGGCGAGACTACAACAGCTACGGCGCGCTT
                      ____________________________________________________________
consensus GTTTTCAGTTCTGGGAATTGAATGCTTTTTCGGCGAGACTACAACAGCTACGGCGCGCTT
 
. : . : . : . : . : . :
JMFS052G07+ AGCAGCTGCCGAGAATGTTAATACGAGTAGAGTTCTAGGTAACAACGAGAATAGCAATAG
JMFS010G07+ AGCAGCTGCCGAGAATGTTAATACGAGTAGAGTACTAGGTAACAACGAGAATAGCAATAG
JMSF052P06+ AGCAGCTGCTGAGAATGTTAATACGAGTAGAGTACTAGGTAACAACGAGAATAGCAATAG
                      ____________________________________________________________
consensus AGCAGCTGCCGAGAATGTTAATACGAGTAGAGTACTAGGTAACAACGAGAATAGCAATAG
 
. : . : . : . : . : . :
JMFS052G07+ CAATAGTAATAGGATTACGCTATGAGGGTATAGGGAAGGGAAGAAAAGGAGCGATCTTTC
JMFS010G07+ CAATAGTAATAGGATTACGCTATGAGGGTATAGGGAAGGGAAGAAAAGGAGCGATCTTTC
JMSF052P06+ CAATAGTAATAGGATTACGCTATGAGGGTATAGGGAAGGGAAGAAAAGGAGCGATCTTTC
                      ____________________________________________________________
consensus CAATAGTAATAGGATTACGCTATGAGGGTATAGGGAAGGGAAGAAAAGGAGCGATCTTTC
 
. : . : . : . : . : . :
JMFS052G07+ TTTCACTGGCCTGCAATGGCTGGCAAAGTCTGCGAACTACTACTACGGCGAGTAG
JMFS010G07+ TTTCACTGGCCTGCAATGGCTGGCAAAGTCTGCGAACTACTACTACGGCGAGTAG
JMSF052P06+ TTTCACTGGCCTGCAATGGCTGGCAAAGTCTGCGAACTACTACTACGGCGAGTAGGCGGA
                      ____________________________________________________________
consensus TTTCACTGGCCTGCAATGGCTGGCAAAGTCTGCGAACTACTACTACGGCGAGTAGGCGGA
 
. : . : . : . : . : . :
JMSF052P06+ GGAAGGGGCAGAGCAGCTTTTGCTTTTTCGTCGTTTTAGGCTTGCTTTAGTCATGTGCCC
                      ____________________________________________________________
consensus GGAAGGGGCAGAGCAGCTTTTGCTTTTTCGTCGTTTTAGGCTTGCTTTAGTCATGTGCCC