Previous Contig 008140:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS107D01Sequence627008140 (2)gb:AP001314_18211852e-35Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:T6J22.
JMSF052O17Sequence602008140 (2)gb:BT008297_16395141e-52Arabidopsis thaliana At3g30300 gene, complete cds.>gb:AK117160_1815207 Arabidops931024530gb:BT008297_16395141e-06Arabidopsis thaliana At3g30300 gene, complete cds.>gb:AK117160_1815207 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS107D01+ TAGGGTCACAAGGCAGGGTTTACCT
                      ____________________________________________________________
consensus TAGGGTCACAAGGCAGGGTTTACCT
 
. : . : . : . : . : . :
JMFS107D01+ GTGCACACCCTCGGGTAGTCATCCAANAATGAATGGAAAAGCATATCTAACTTGTTCCCA
                      ____________________________________________________________
consensus GTGCACACCCTCGGGTAGTCATCCAANAATGAATGGAAAAGCATATCTAACTTGTTCCCA
 
. : . : . : . : . : . :
JMFS107D01+ TTTCTGAGCTATTTGTAGGCTACTTGAACAGAGATCACAAGTTTGAAGAAGATTCTTGAG
                      ____________________________________________________________
consensus TTTCTGAGCTATTTGTAGGCTACTTGAACAGAGATCACAAGTTTGAAGAAGATTCTTGAG
 
. : . : . : . : . : . :
JMFS107D01+ TTCAAATAAGAGTATAAACTATAGATCTTATACTCATTTGAGTTGTAACATTATGAATTA
                      ____________________________________________________________
consensus TTCAAATAAGAGTATAAACTATAGATCTTATACTCATTTGAGTTGTAACATTATGAATTA
 
. : . : . : . : . : . :
JMFS107D01+ TATTTCTAGACACGGTTTATGTAGTAACTTAACAAGTTATATTACTTCTGTCAAAGATAA
                      ____________________________________________________________
consensus TATTTCTAGACACGGTTTATGTAGTAACTTAACAAGTTATATTACTTCTGTCAAAGATAA
 
. : . : . : . : . : . :
JMFS107D01+ GCACACTATTTTCATCGAAAACATTGCAGAACCAAATTGAACTAGCAATAGCTAAACCAC
                      ____________________________________________________________
consensus GCACACTATTTTCATCGAAAACATTGCAGAACCAAATTGAACTAGCAATAGCTAAACCAC
 
. : . : . : . : . : . :
JMFS107D01+ AAATTGGAAAGATTGTTCCCTATTCACCTGCAAACATCCACCATCAGAAACAACAAGCTC
                      ____________________________________________________________
consensus AAATTGGAAAGATTGTTCCCTATTCACCTGCAAACATCCACCATCAGAAACAACAAGCTC
 
. : . : . : . : . : . :
JMFS107D01+ AACAACCGAGTGTCGAGTCAGCACGGGGAGAACATGGCGCAGGTAAAAAGACGGCGAAGC
                      ____________________________________________________________
consensus AACAACCGAGTGTCGAGTCAGCACGGGGAGAACATGGCGCAGGTAAAAAGACGGCGAAGC
 
. : . : . : . : . : . :
JMFS107D01+ TGAGTATGACACTCTGAACGAAGGAATTTCTTTCTTCCTCCTCGCTCCTTTGAGATTTTT
JMSF052O17+ TT
                      ____________________________________________________________
consensus TGAGTATGACACTCTGAACGAAGGAATTTCTTTCTTCCTCCTCGCTCCTTTGAGATTTTT
 
. : . : . : . : . : . :
JMFS107D01+ CGGAAGGGTTTTCACGATTTTCACATCGTTTGCCAAAGCTGCCATGAACTGATCCTCATT
JMSF052O17+ CGGAAGGGTTTTCACGATTTTCACATCGTTTGCCAAAGCTGCCATGAACTGATCCTCATT
                      ____________________________________________________________
consensus CGGAAGGGTTTTCACGATTTTCACATCGTTTGCCAAAGCTGCCATGAACTGATCCTCATT
 
. : . : . : . : . : . :
JMFS107D01+ GTAGAGGTAAGCAAAACTCTTGAACTCTGAGCTGATCCCCTTGCTGCTCGTCGTAGACTG
JMSF052O17+ GTAGAGGTAAGCAAAACTCTTGAACTCTGAGCTGATCCCCTTGCTGCTCGTCGTAGACTG
                      ____________________________________________________________
consensus GTAGAGGTAAGCAAAACTCTTGAACTCTGAGCTGATCCCCTTGCTGCTCGTCGTAGACTG
 
. : . : . : . : . : . :
JMFS107D01+ AA
JMSF052O17+ AATCTCTGGAACAACGAGCGTAGCATTGAGAAGTCGAGCAACAGCAACAACATCCGAAAT
                      ____________________________________________________________
consensus AATCTCTGGAACAACGAGCGTAGCATTGAGAAGTCGAGCAACAGCAACAACATCCGAAAT
 
. : . : . : . : . : . :
JMSF052O17+ CGAATTCCTGATCTCATGGAAACCGCCTCGTATCCTCACAAAGATAAACCCAGTTGACAT
                      ____________________________________________________________
consensus CGAATTCCTGATCTCATGGAAACCGCCTCGTATCCTCACAAAGATAAACCCAGTTGACAT
 
. : . : . : . : . : . :
JMSF052O17+ AACTTCAGGAGCTGGATAATTGGATCCAGGATTGGCATCAGCATGTAAATATTCAAGAGG
                      ____________________________________________________________
consensus AACTTCAGGAGCTGGATAATTGGATCCAGGATTGGCATCAGCATGTAAATATTCAAGAGG
 
. : . : . : . : . : . :
JMSF052O17+ CCTAACCGGACCCCAAAGTCTTTCATGAATCAGATTAGCACTGGGAAGATCTGCATTGTC
                      ____________________________________________________________
consensus CCTAACCGGACCCCAAAGTCTTTCATGAATCAGATTAGCACTGGGAAGATCTGCATTGTC
 
. : . : . : . : . : . :
JMSF052O17+ GAAAATGGGCCTCCACGAGAATATGGTGACAGAAGACCGGAACTCCGACACGGCGGCGCC
                      ____________________________________________________________
consensus GAAAATGGGCCTCCACGAGAATATGGTGACAGAAGACCGGAACTCCGACACGGCGGCGCC
 
. : . : . : . : . : . :
JMSF052O17+ GCCGTAAGTGTGGCGAGCAAGAAGAAAGTGGGTGACGAGGGAGAGAGCAGAGACGACCAG
                      ____________________________________________________________
consensus GCCGTAAGTGTGGCGAGCAAGAAGAAAGTGGGTGACGAGGGAGAGAGCAGAGACGACCAG
 
. : . : . : . : . : . :
JMSF052O17+ CCCCACTAGCCCCACCCATTTCATCTTCTTCGACACCATCGTCTTCCCTTCCCCTTTAGT
                      ____________________________________________________________
consensus CCCCACTAGCCCCACCCATTTCATCTTCTTCGACACCATCGTCTTCCCTTCCCCTTTAGT
 
. : . : . : . : . : . :
JMSF052O17+ CTTCACCCACTTCATCTCCACCCAGCAAGAACACAGTTACACAGAGAACACTGCCCCCCC
                      ____________________________________________________________
consensus CTTCACCCACTTCATCTCCACCCAGCAAGAACACAGTTACACAGAGAACACTGCCCCCCC