Previous Contig 008139:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS100G04Sequence612008139 (6)gb:AE016959_10221823e-42Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC11
JMSF012M02Sequence256008139 (6)gb:AP001081_18207702e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0693B08
JMSF037B18Sequence681008139 (6)gb:AE016959_10221824e-49Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC11735013081 (3)pir|T52043|T520431e-54probable glutamate-tRNA ligase (EC 6.1.1.17) [imported] - Arabidopsis thaliana>g
JMSF046D15Sequence708008139 (6)gb:AE016959_10221822e-51Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC11755013081 (3)pir|T52043|T520433e-58probable glutamate-tRNA ligase (EC 6.1.1.17) [imported] - Arabidopsis thaliana>g
JMSF047B11Sequence651008139 (6)gb:AP001081_18207703e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0693B08749024242pir|T52043|T520437e-51probable glutamate-tRNA ligase (EC 6.1.1.17) [imported] - Arabidopsis thaliana>g
JMSF052O10Sequence574008139 (6)gb:AP001081_18207701e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0693B08

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047B11+ TCTGGAAGA
                      ____________________________________________________________
consensus TCTGGAAGA
 
. : . : . : . : . : . :
JMSF047B11+ TCTACCTCAAATGTAGCAGTAGCAGGATTAGCATTTGAAACTTGGTGTTCATTTACTTTG
                      ____________________________________________________________
consensus TCTACCTCAAATGTAGCAGTAGCAGGATTAGCATTTGAAACTTGGTGTTCATTTACTTTG
 
. : . : . : . : . : . :
JMSF047B11+ GTTGCTGCCTTTGCAGAGCTCTTTTTCCCAATATATGTTGTGATGACTTCACCCAGTTCA
JMSF046D15+ TGCTGCCTTTGTGGAGCCCTTTTTCCCTATATATGTTGCGATGACTTCACCAAGAACA
JMSF037B18+ ATATATGTTGCGATGACTTCACCAAGAACA
                      ____________________________________________________________
consensus GTTGCTGCCTTTGTGGAGCTCTTTTTCCCTATATATGTTGCGATGACTTCACCAAGAACA
 
. : . : . : . : . : . :
JMSF047B11+ GCTTCATATGCTTCAAATATTGAGTTGAACCACCTTACCAGATTTTGGAATTTCTTTGAT
JMSF046D15+ GCTTCATATGCTACAAATATTGTGTTGAACCACCTTACCAGATTTTGGTATTTCTTTGAT
JMFS100G04+ CTTACCAGATTTTGGTATTTCTTTGAT
JMSF037B18+ GCTTCATATGCTACAAATATTGTGTTGAACCACCTTACCAGATTTTGGTATTTCTTTGAT
                      ____________________________________________________________
consensus GCTTCATATGCTACAAATATTGTGTTGAACCACCTTACCAGATTTTGGTATTTCTTTGAT
 
. : . : . : . : . : . :
JMSF047B11+ CTTCTGAGGCTTTCCCATCTCGGCCCAGCTCCTGCAAGACCAGACCAGACAGCAATATCT
JMSF046D15+ CTTCTAAGACTTTCCCATCTCTGTCCAGCTCCTGCAAGACCAGACCAGACAGCAATATCT
JMFS100G04+ CTTCTAAGACTTTCCCATCTCTGTCCAGCTCCTGCAAGACCAGACCAGACAGCAATATCT
JMSF037B18+ CTTCTAAGACTTTCCCATCTCTGTCCAGCTCCTGCAAGACCAGACCAGACAGCAATATCT
                      ____________________________________________________________
consensus CTTCTAAGACTTTCCCATCTCTGTCCAGCTCCTGCAAGACCAGACCAGACAGCAATATCT
 
. : . : . : . : . : . :
JMSF047B11+ GCAATTGAAAGGCTGTTCCCAACCAAAAATGTGCGGTGAAGCAGAAATTGATCCACATAA
JMSF046D15+ GCAATTGAAAGACTATTCCCAACCAAAAATGTGTGCTGCATCAGAAATTGGTCCACATAA
JMFS100G04+ GCAATTGAAAGACTATTCCCAACCAAAAATGTGTGCTGCATCAGAAATTGGTCCACATAA
JMSF037B18+ GCAATTGAAAGACTATTCCCAACCAAAAATGTGTGCTGCATCAGAAATTGGTCCACATAA
                      ____________________________________________________________
consensus GCAATTGAAAGACTATTCCCAACCAAAAATGTGTGCTGCATCAGAAATTGGTCCACATAA
 
. : . : . : . : . : . :
JMSF047B11+ CCACATGCAGCCTGAAATTCAGAGCCAGATGCAAAAATAGGAGCATACTCTAGCCATTCA
JMSF046D15+ TTGCATGCTCCCTGAAATTCAGAGCCAGATGCAAAAGTAGGGGCATACTCCAGCCATTCA
JMFS100G04+ TTGCATGCTCCCTGAAATTCAGAGCCAGATGCAAAAGTAGGGGCATACTCCAGCCATTCA
JMSF037B18+ TTGCATGCTCCCTGAAATTCAGAGCCAGATGCAAAAGTAGGGGCATACTCCAGCCATTCA
                      ____________________________________________________________
consensus TTGCATGCTCCCTGAAATTCAGAGCCAGATGCAAAAGTAGGGGCATACTCCAGCCATTCA
 
. : . : . : . : . : . :
JMSF047B11+ TCTATCTGGCTAGACTCAAAGGAATCCCGCTGGTAGAATTCTGGAATCCTTGCTACACGA
JMSF012M02+ CTTGCTACACGA
JMSF046D15+ TCTATCTGGCTAGACTCAAACGAATCCCGCCGGTATAATCCAGGAGTGCTTGCTACACGG
JMFS100G04+ TCTATCTGGCTAGACTCAAACGAATCCCGCCGGTATAATCCAGGAGTGCTTGCTACACGG
JMSF037B18+ TCTATCTGGCTAGACTCAAACGAATCCCGCCGGTATAATCCAGGAGTGCTTGCTACACGG
JMSF052O10+ CTGGCTAGACTCAAACGAATCCCGCCGGTATAATCCAGGAGTGCTTGCTACACGG
                      ____________________________________________________________
consensus TCTATCTGGCTAGACTCAAACGAATCCCGCCGGTATAATCCAGGAGTGCTTGCTACACGG
 
. : . : . : . : . : . :
JMSF047B11+ CCAATATACCTTAAGAGAACAAAAGTTCCCTGCAACTTTGATCCATTAGGTAAAAGAATC
JMSF012M02+ CCAATATACCTTAAGAGAACAAAAGTTCCCTGCAACTTTGATCCATTAGGTAAAAGAATC
JMSF046D15+ CCAATATACCTTAACAGAACAAAAGTTCCCCGCAACTTTGATCCATTAGGTAGTAGAACT
JMFS100G04+ CCAATATACCTTAACAGAACAAAAGTTCCCCGCAACTTTGATCCATTAGGTAGTAGAACT
JMSF037B18+ CCAATATACCTTAACAGAACAAAAGTTCCCCGCAACTTTGATCCATTAGGTAGTAGAACT
JMSF052O10+ CCAATATACCTTAACAGAACAAAAGTTCCCCGCAACTTTGATCCATTAGGTAGTAGAACT
                      ____________________________________________________________
consensus CCAATATACCTTAACAGAACAAAAGTTCCCCGCAACTTTGATCCATTAGGTAGTAGAACT
 
. : . : . : . : . : . :
JMSF047B11+ GTGGGCGGAGAACCAGGGCTGAGGGTTGCATCAGTGGAAAAAGAAACTCCAGAGATTTTT
JMSF012M02+ GTGGGCGGAGAACCAGGGCTGAGGGTTGCATCAGTGGAAAAAGAAACTCCAGAGATTTTT
JMSF046D15+ GTGGGTGGAGAACCAGGGCTGAGAGTTGCATCTGCGGAAAAAGCAACACCGGCAATTTTT
JMFS100G04+ GTGGGTGGAGAACCAGGGCTGAGAGTTGCATCTGCGGAAAAAGCAACACCGGCAATTTTT
JMSF037B18+ GTGGGTGGAGAACCAGGGCTGAGAGTTGCATCTGCGGAAAAAGCAACACCGGCAATTTTT
JMSF052O10+ GTGGGTGGAGAACCAGGGCTGAGAGTTGCATCTGCGGAAAAAGCAACACCGGCAATTTTT
                      ____________________________________________________________
consensus GTGGGTGGAGAACCAGGGCTGAGAGTTGCATCTGCGGAAAAAGCAACACCGGCAATTTTT
 
. : . : . : . : . : . :
JMSF047B11+ GCAGCAACAAAGATGGCCAGTGGAGGACTATCAGATGAAAATAAGATCTTGATTTCCAT
JMSF012M02+ GCAGCAACAAAGATGGCCAGTGGAGGACTATCAGATGAAAATAAGATCTTGATTTCCAT
JMSF046D15+ GCAGCAACAAAGACAGCCAGCGGAGGACTATCAGAGGATAATAGGATTTTGAGTTCCATA
JMFS100G04+ GCAGCAACAAAGACAGCCAGCGGAGGACTATCAGAGGATAATAGGATTTTGAGTTCCATA
JMSF037B18+ GCAGCAACAAAGACAGCCAGCGGAGGACTATCAGAGGATAATAGGATTTTGAGTTCCATA
JMSF052O10+ GCAGCAACAAAGACAGCCAGCGGAGGACTATCAGAGGATAATAGGATTTTGAGTTCCATA
                      ____________________________________________________________
consensus GCAGCAACAAAGACAGCCAGCGGAGGACTATCAGAGGATAATAGGATTTTGAGTTCCATA
 
. : . : . : . : . : . :
JMSF046D15+ GTAGCTGATCACTAGAAGACTGGTGATCAGCAATGGCAGATTCAAAGTGCTATTTCGCGA
JMFS100G04+ GTAGCTGATCACTAGAAGACTGGTGATCAGCAATGGCAGATTCAAAGTGCTATTTCGCGA
JMSF037B18+ GTAGCTGATCACTAGAAGACTGGTGATCAGCAATGGCAGATTCAAAGTGCTATTTCGCGA
JMSF052O10+ GTAGCTGATCACTAGAAGACTGGTGATCAGCAATGGCAGATTCAAAGTGCTATTTCGCGA
                      ____________________________________________________________
consensus GTAGCTGATCACTAGAAGACTGGTGATCAGCAATGGCAGATTCAAAGTGCTATTTCGCGA
 
. : . : . : . : . : . :
JMSF046D15+ GGGCGAACTACTAGTTCTTGTTGAGTGATCGCAACTCGCCTGTAGCTCTGCCGACTAGGT
JMFS100G04+ GGGCGAACTACTAGTTCTTGTTGAGTGATCGCAACTCGCCTGTAGCTCTGCCGACTAGGT
JMSF037B18+ GGGCGAACTACTAGTTCTTGTTGAGTGATCGCAACTCGCCTGTAGCTCTGCCGACTAGGT
JMSF052O10+ GGGCGAACTACTAGTTCTTGTTGAGTGATCGCAACTCGCCTGTAGCTCTGCCGACTAGGT
                      ____________________________________________________________
consensus GGGCGAACTACTAGTTCTTGTTGAGTGATCGCAACTCGCCTGTAGCTCTGCCGACTAGGT
 
. : . : . : . : . : . :
JMSF046D15+ GTTCGAGCTCAACGAGCCCGATGAGCGATGGCGGCGCTAGTCCC
JMFS100G04+ GTTCGAGCTCAACGAGCCCGATGAGCGATGGCGGCGCTAGTCCC
JMSF037B18+ GTTCGAGCTCAACGAGCCCGATGAGCGATGGCGGCGCTAGTCCC
JMSF052O10+ GTTCGAGCTCAACGAGCCCGATGAGCGATGGCGGCGCTAGTCCCGGTGGTTTCTTCTTTC
                      ____________________________________________________________
consensus GTTCGAGCTCAACGAGCCCGATGAGCGATGGCGGCGCTAGTCCCGGTGGTTTCTTCTTTC