Previous Contig 008135:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008G06Sequence641008135 (4)gb:AB023032_15153287e-42Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.
JMFS022E08Sequence635008135 (4)gb:AB023032_15153284e-39Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.
JMSF008J18Sequence398008135 (4)gb:AB023032_15153283e-13Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.763009936 (7)gb:AP003334_18281311e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B111
JMSF052N15Sequence669008135 (4)gb:AB023032_15153281e-39Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14.900024527gb:AY139764_15823844e-36Arabidopsis thaliana AT5g42220/K5J14_2 mRNA, complete cds.>gb:BT006364_1639251 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS008G06+ GCCTTCTGCTGCTTCATTTCCTTGTGAAGCAAAA
                      ____________________________________________________________
consensus GCCTTCTGCTGCTTCATTTCCTTGTGAAGCAAAA
 
. : . : . : . : . : . :
JMFS008G06+ GTGGGAGCAGTAACCTGCACGCCAGGATGTTGGCCACCAATCTGGCTCCCAATTCCAACA
JMFS022E08+ CA
JMSF052N15+ CA
                      ____________________________________________________________
consensus GTGGGAGCAGTAACCTGCACGCCAGGATGTTGGCCACCAATCTGGCTCCCAATTCCAACA
 
. : . : . : . : . : . :
JMFS008G06+ GAGTTTAAAACTGCCCCAATAACCCGACTTAGATCGGGAACAAGACCGCCTCCTTGATCA
JMFS022E08+ GAGTTTAAAACTGCCCCAATAACCCGACTTAGATCGGGAACAAGACCGCCTCCTTGATCA
JMSF052N15+ GAGTTTAAAACTGCCCCAATAACCCGACTTAGATCGGGAACAAGACCGCCTCCTTGATCA
                      ____________________________________________________________
consensus GAGTTTAAAACTGCCCCAATAACCCGACTTAGATCGGGAACAAGACCGCCTCCTTGATCA
 
. : . : . : . : . : . :
JMFS008G06+ CCAACATTGAAAGTGCCTAGCATAACACTATGCGAAATTTGCCCAATTTGGCTGCGTGAG
JMFS022E08+ CCAACATTGAAAGTGCCTAGCATAACACTATGCGAAATTTGCCCAATTCGGCTGCGTGAG
JMSF052N15+ CCAACATTGAAAGTGCCTAGCATAACACTATGCGAAATTTGCCCAATTCGGCTGCGTGAG
                      ____________________________________________________________
consensus CCAACATTGAAAGTGCCTAGCATAACACTATGCGAAATTTGCCCAATTCGGCTGCGTGAG
 
. : . : . : . : . : . :
JMFS008G06+ GCACCAGTGGTTGGATCTTGTCCATTAGGTGCAGTAGCCTCTGTAGTGTTGGAACCAGAT
JMFS022E08+ GCACCAGTGGTTGGATCTTGTCCATTAGGTGCAGTAGCCTCTGTAGTGTTGGAACCAGAT
JMSF052N15+ GCACCAGTGGTTGGATCTTGTCCATTAGGTGCAGTAGCCTCTGTAGTGTTGGAACCAGAT
                      ____________________________________________________________
consensus GCACCAGTGGTTGGATCTTGTCCATTAGGTGCAGTAGCCTCTGTAGTGTTGGAACCAGAT
 
. : . : . : . : . : . :
JMFS008G06+ GAGGATTGTTGCTGGGACAGCTCTCTTACCAAGTGCAATGCATCCCCATTCTCCAAATGA
JMFS022E08+ GAGGATTGTTGCTGGGACAGCTCTCTTACCAAGTGCAATGCATCCCCATTCTCCAAATGA
JMSF052N15+ GAGGATTGTTGCTGGGACAGCTCTCTTACCAAGTGCAATGCATCCCCATTCTCCAAATGA
                      ____________________________________________________________
consensus GAGGATTGTTGCTGGGACAGCTCTCTTACCAAGTGCAATGCATCCCCATTCTCCAAATGA
 
. : . : . : . : . : . :
JMFS008G06+ TATTCTGAAAGGAGGTGGCCATCCTTCAAAACCTTCCCCCGAAAAATAAGCCTCTGCTGT
JMFS022E08+ TATTCTGAAAGGAGGTGGCCATCCTTCAAAACCTTCCCCCGAAAAATAAGCCTCTGCTGT
JMSF008J18+ TCCTTCAAANCCTTCCCCCGAAAAATAAGCNTCTGCTGT
JMSF052N15+ TATTCTGAAAGGAGGTGGCCATCCTTCAAAACCTTCCCCCGAAAAATAAGCCTCTGCTGT
                      ____________________________________________________________
consensus TATTCTGAAAGGAGGTGGCCATCCTTCAAAACCTTCCCCCGAAAAATAAGCCTCTGCTGT
 
. : . : . : . : . : . :
JMFS008G06+ ACTACAGGGACACCAGTTTGAGCAGCTACTTTCTCCTTCAAGGCAGAAACTTGAATATTC
JMFS022E08+ ACTACAGGGACACCAGTTTGAGCAGCTACTTTCTCCTTCAAGGCAGAAACTTGAATATTC
JMSF008J18+ ACTACAGGGACACCAGTTTGAGCAGCTACTTTCTCCTTCAAGGCAGAAACTTGAATATTC
JMSF052N15+ ACTACAGGGACACCAGTTTGAGCAGCTACTTTCTCCTTCAAGGCAGAAACTTGAATATTC
                      ____________________________________________________________
consensus ACTACAGGGACACCAGTTTGAGCAGCTACTTTCTCCTTCAAGGCAGAAACTTGAATATTC
 
. : . : . : . : . : . :
JMFS008G06+ TTGTCCACATGGAAAACATGATTCTGCGAATCTAAGGTCTTGATATTGATCTTAATTGAT
JMFS022E08+ TTGTCCACATGGAAAACATGATTCTGCGAATCTAAGGTCTTGATATTGATCTTAATTGAT
JMSF008J18+ TTGTCCACATGGAAAACATGATTCTGCGAATCTAAGGTCTTGATATTGATCTTAATTGAT
JMSF052N15+ TTGTCCACATGGAAAACATGATTCTGCGAATCTAAGGTCTTGATATTGATCTTAATTGAT
                      ____________________________________________________________
consensus TTGTCCACATGGAAAACATGATTCTGCGAATCTAAGGTCTTGATATTGATCTTAATTGAT
 
. : . : . : . : . : . :
JMFS008G06+ GATTCAGAAACTCCTCCAGAAGCATTGCTTGTGTTTGGATCCGCAGATGGATGCTGGTCT
JMFS022E08+ GATTCAGAAACTCCTCCAGAAGCATTGCTTGTGTTTGGATCCGCAGATGGATGCTGGTCT
JMSF008J18+ GATTCAGAAACTCCTCCAGAAGCATTGCTTGTGTTTGGATCCGCAGATGGATGCTGGTCT
JMSF052N15+ GATTCAGAAACTCCTCCAGAAGCATTGCTTGTGTTTGGATCCGCAGATGGATGCTGGTCT
                      ____________________________________________________________
consensus GATTCAGAAACTCCTCCAGAAGCATTGCTTGTGTTTGGATCCGCAGATGGATGCTGGTCT
 
. : . : . : . : . : . :
JMFS008G06+ GCCATGTAGCTTGAAAAGAATTAATGCCTATACAGGAGAGGAGAGAAGATCGAAGACTGA
JMFS022E08+ GCCATGTAGCTTGAAAAGAATTAATGCCTATACAGGAGAGGAGAGAAGATCGAAGACTGA
JMSF008J18+ GCCATGTAGCTTGAAAAGAATTAATGCCTATACAGGAGAGGAGAGAAGATCGAAGACTGA
JMSF052N15+ GCCATGTAGCTTGAAAAGAATTAATGCCTATACAGGAGAGGAGAGAAGATCGAAGACTGA
                      ____________________________________________________________
consensus GCCATGTAGCTTGAAAAGAATTAATGCCTATACAGGAGAGGAGAGAAGATCGAAGACTGA
 
. : . : . : . : . : . :
JMFS008G06+ AGCGCGA
JMFS022E08+ AGCGCGATTGATATTTTCGTTCAAACACTAAAACGTAACCAACCAGATTTTTGACGTAGA
JMSF008J18+ AGCGCGATTGATATTTTCGTTCAAACACTAAAACGTAACCAACCAGATTTTTGACGTAGA
JMSF052N15+ AGCGCGATTGATATTTTCGTTCAAACACTAAAACGTAACCAACCAGATTTTTGACGTAGA
                      ____________________________________________________________
consensus AGCGCGATTGATATTTTCGTTCAAACACTAAAACGTAACCAACCAGATTTTTGACGTAGA
 
. : . : . : . : . : . :
JMFS022E08+ GAAAGGGCAAGAGGAGAAATGTGCTGCAGCGAC
JMSF008J18+ GAAAGGGCAAGAGGAGAAATGTGCTGCAGCGACTCTCGTCTGCTTCAAGGAAATCGCCC
JMSF052N15+ GAAAGGGCAAGAGGAGAAATGTGCTGCAGCGACTCTCGTCTGCTTCAAGGAAATCGCCCC
                      ____________________________________________________________
consensus GAAAGGGCAAGAGGAGAAATGTGCTGCAGCGACTCTCGTCTGCTTCAAGGAAATCGCCCC