Previous Contig 008132:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014F24Sequence591008132 (3)gb:AK117385_18154231e-14Arabidopsis thaliana At1g61240 mRNA for unknown protein, complete cds, clone: RA828008526 (4)gb:AP003705_18321601e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF027P24Sequence626008132 (3)gb:AK117385_18154233e-18Arabidopsis thaliana At1g61240 mRNA for unknown protein, complete cds, clone: RA692008526 (4)gb:AK117385_18154232e-49Arabidopsis thaliana At1g61240 mRNA for unknown protein, complete cds, clone: RA
JMSF052M11Sequence655008132 (3)gb:AK117385_18154237e-14Arabidopsis thaliana At1g61240 mRNA for unknown protein, complete cds, clone: RA927008526 (4)gb:AK117385_1815423e-113Arabidopsis thaliana At1g61240 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014F24+ TGGCATTGCCAACAAGTTCAGAGATCCAGGACGATCAGCC-
JMSF027P24+ CAACTGGCATTGCCAACAAGTTCAGAGATCCAGGACGATCAGCCT
                      ____________________________________________________________
consensus CAACTGGCATTGCCAACAAGTTCAGAGATCCAGGACGATCAGCCT
 
. : . : . : . : . : . :
JMFF014F24+ TTGATTCCAAAGCACTCAATGCCCAGAGAGGCTTTAGTTCAAGATCTGATCTAGGTTCAC
JMSF027P24+ TTGATTCCAAAGCACTCAATGCCCAGAGAGGCTTTAGTTCAAGATCTGATCTAGGTTCAC
                      ____________________________________________________________
consensus TTGATTCCAAAGCACTCAATGCCCAGAGAGGCTTTAGTTCAAGATCTGATCTAGGTTCAC
 
. : . : . : . : . : . :
JMFF014F24+ TAATACCACGAGGTAAACTGTTCGACCTTTTGCTCGCCATACCAGAACGCTTCAAAGTGT
JMSF027P24+ TAATACCACGAGGTAAACTGTTCGACCTTTTGCTCGCCATACCAGAACGCTTCAAGGTGT
                      ____________________________________________________________
consensus TAATACCACGAGGTAAACTGTTCGACCTTTTGCTCGCCATACCAGAACGCTTCAAGGTGT
 
. : . : . : . : . : . :
JMFF014F24+ AGGAGGGACCATATTCTGATACTGTCTCAGTCCGTTGATACTGAAAATTAGTTGTTCTAT
JMSF027P24+ AGGAGGGACCATATTCTGATACTGTCTCAGTCCGTTGATACTGAAAATTAGTTGTTCTAT
JMSF052M11+ CTCAGTCCGTTGATACTGAAAATTAGTTGTTCTAT
                      ____________________________________________________________
consensus AGGAGGGACCATATTCTGATACTGTCTCAGTCCGTTGATACTGAAAATTAGTTGTTCTAT
 
. : . : . : . : . : . :
JMFF014F24+ ATACAATAAATAGCATTACTGTAAATATAATTCCCATAAATGGAAGCTGTTTCATCTTCA
JMSF027P24+ ATACAATAAATAGCATTACTGTAAATATAATTCCCATAAATGGAAGCTGTTTCATCTTCA
JMSF052M11+ ATACAATAAATAGCATTACTGTAAATATAATTCCCATAAATGGAAGCTGTTTCATCTTCA
                      ____________________________________________________________
consensus ATACAATAAATAGCATTACTGTAAATATAATTCCCATAAATGGAAGCTGTTTCATCTTCA
 
. : . : . : . : . : . :
JMFF014F24+ TTCCACATATTCCCCCTTTAAAAAAGACACTTCTTTTCTTCATTAACAGCCTCCATGATT
JMSF027P24+ TTCCACATATTCCCCCTTTAAAAAAGACACTTCTTTTCTTCATTAACAGCCTCCATGATT
JMSF052M11+ TTCCACATATTCCCCCTTTAAAAAAGACACTTCTTTTCTTCATTAACAGCCTCCATGATT
                      ____________________________________________________________
consensus TTCCACATATTCCCCCTTTAAAAAAGACACTTCTTTTCTTCATTAACAGCCTCCATGATT
 
. : . : . : . : . : . :
JMFF014F24+ CCAACTCCTTCATATGCACAAAGAGCACTGAAAGACCTTACAAGCTCTAACCCGATCCGG
JMSF027P24+ CCAATTCCTTCATATGCACAAAGAGCACTGAAAGACCTTACAAGCTCTAACCCGATCCGG
JMSF052M11+ CCAATTCCTTCATATGCACAAAGAGCACTGAAAGACCTTACAAGCTCTAACCCGATCCGG
                      ____________________________________________________________
consensus CCAATTCCTTCATATGCACAAAGAGCACTGAAAGACCTTACAAGCTCTAACCCGATCCGG
 
. : . : . : . : . : . :
JMFF014F24+ TAACCCGCCCCGACAGCGAGAAACGCGTGCCTGCACTGACATTTAGCTTGAAGAATGAGA
JMSF027P24+ TAACCCGCCCCGACAGCGAGAAACGCGTGCCTGCACTGACATTTAGCTTGAAGAATGAGA
JMSF052M11+ TAACCCGCCCCGACAGCGAGAAACGCGTGCCTGCACTGACATTTAGCTTGAAGAATGAGA
                      ____________________________________________________________
consensus TAACCCGCCCCGACAGCGAGAAACGCGTGCCTGCACTGACATTTAGCTTGAAGAATGAGA
 
. : . : . : . : . : . :
JMFF014F24+ TGGAAATGAACCTCTGCAGCTCCGGCGGGCACTGGGTGATGAATAGACAAAATTTGCGTG
JMSF027P24+ TGGAAATGAACCTCTGCAGCTCCGGCGGGCACTGGGTGATGAATAGACAAAATTTGCGTG
JMSF052M11+ TGGAAATGAACCTCTGCAGCTCCGGCGGGCACTGGGTGATGAATAGACAAAATTTGCGTG
                      ____________________________________________________________
consensus TGGAAATGAACCTCTGCAGCTCCGGCGGGCACTGGGTGATGAATAGACAAAATTTGCGTG
 
. : . : . : . : . : . :
JMFF014F24+ TTTTAGCTTAGCTTCAAGTATAAGTTGGTGCTGTCGGGAAGAGAATCGGAGAGCAAAGTG
JMSF027P24+ TTTTAGCTTAGCTTCAAGTATAAGTTGGTGCTGTCGGGAAGAGAATCGGAGAGCAAAGTG
JMSF052M11+ TTTTAGCTTAGCTTCAAGTATAAGTTGGTGCTGTCGGGAAGAGAATCGGAGAGCAAAGTG
                      ____________________________________________________________
consensus TTTTAGCTTAGCTTCAAGTATAAGTTGGTGCTGTCGGGAAGAGAATCGGAGAGCAAAGTG
 
. : . : . : . : . : . :
JMFF014F24+ TAATTGTAAAT
JMSF027P24+ TAATTGTAAATACGGATAGAGAGAGAATGCTTACATTGTT
JMSF052M11+ TAATTGTAAATACGGATAGAGAGAGAATGCTTACATTGTTGTGTATATACTGTAGTTTTA
                      ____________________________________________________________
consensus TAATTGTAAATACGGATAGAGAGAGAATGCTTACATTGTTGTGTATATACTGTAGTTTTA
 
. : . : . : . : . : . :
JMSF052M11+ CGAAAGTATTTCTGTCGGGGAAAAAGAGAGAGAGAGAGTGGTGGGGGAGAAGAAGAAACC
                      ____________________________________________________________
consensus CGAAAGTATTTCTGTCGGGGAAAAAGAGAGAGAGAGAGTGGTGGGGGAGAAGAAGAAACC