Previous Contig 008125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS054E04Sequence575008125 (3)gb:AB098525_15261092e-44Petunia x hybrida mRNA for PHCLF3, complete cds.
JMFS146D12Sequence621008125 (3)gb:AB098525_15261095e-45Petunia x hybrida mRNA for PHCLF3, complete cds.
JMSF052K21Sequence658008125 (3)gb:AB098525_15261093e-45Petunia x hybrida mRNA for PHCLF3, complete cds.869011962 (3)gb:AB098525_1526109e-128Petunia x hybrida mRNA for PHCLF3, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS146D12+ TTCCATGTTGATCATAGTAAATACGCCGCC
JMFS054E04+ TTCCATGTTGATCATAGTAAATACGCNGCC
JMSF052K21+ CCTCACTGTCACTGCAAATAAGTGCCTCACTTCCATGTTGATCATAGTAAATACGCCGCC
                      ____________________________________________________________
consensus CCTCACTGTCACTGCAAATAAGTGCCTCACTTCCATGTTGATCATAGTAAATACGCCGCC
 
. : . : . : . : . : . :
JMFS146D12+ TTCCAACCACCGATTGGTCTTCAGCCATTCTCTGATTTCTGTCTAAGAAAATCCACGTGG
JMFS054E04+ TTCCAACCACCGATTGGTCTTCAGCCATTCTCTGATTTCTGTCTAAGAAAATCCACGTGG
JMSF052K21+ TTCCAACCACCGATTGGTCTTCAGC--ATCTCTGATTTCTGTCTAAGAAAATCCACGTGG
                      ____________________________________________________________
consensus TTCCAACCACCGATTGGTCTTCAGCCATTCTCTGATTTCTGTCTAAGAAAATCCACGTGG
 
. : . : . : . : . : . :
JMFS146D12+ TATATGGGGGTAACTTGTCAATAAATGGAAGCTTGGCAGTTGTCACGGATACTACTTCTT
JMFS054E04+ TATATGGGGGTAACTTGTCAATAAATGGAAGCTTGGCAGTTGTCACGGATACTACTTCTT
JMSF052K21+ TATATGGGGGTAACTTGTCAATAAATGGAAGCTTGGCAGTTGTCACGGATACTACTTCTT
                      ____________________________________________________________
consensus TATATGGGGGTAACTTGTCAATAAATGGAAGCTTGGCAGTTGTCACGGATACTACTTCTT
 
. : . : . : . : . : . :
JMFS146D12+ GACCACTAGCACAGTCTCTCTCTTCTGATTCTTGGATAAGTCCACTAACTTTACAGAGGG
JMFS054E04+ GACCACTAGCACAGTCTCTCTCTTCTGATTCTTGGATAAGTCCACTAACTTTACAGAGGG
JMSF052K21+ GACCACTAGCACAGTCTCTCTCTTCTGATTCTTGGATAAGTCCACTAACTTTACAGAGGG
                      ____________________________________________________________
consensus GACCACTAGCACAGTCTCTCTCTTCTGATTCTTGGATAAGTCCACTAACTTTACAGAGGG
 
. : . : . : . : . : . :
JMFS146D12+ GATTTTCAATTCTTGAGGAAAGCATTTTACCCAACCCATTGTTCTCATTCTCAAAAGTTG
JMFS054E04+ GATTTTCAATTCTTGAGGAAAGCATTTTACCCAACCCATTGTTCTCATTCTCAAAAGTTG
JMSF052K21+ GATTTTCAATTCTTGAGGAAAGCATTTTACCCAACCCATTGTTCTCATTCTCAAAAGTTG
                      ____________________________________________________________
consensus GATTTTCAATTCTTGAGGAAAGCATTTTACCCAACCCATTGTTCTCATTCTCAAAAGTTG
 
. : . : . : . : . : . :
JMFS146D12+ AAGCATCGGTTCTGGATGCAGTCAGCACTACAAGTTGGGAAAGATGAGTTTCAAGCCTCT
JMFS054E04+ AAGCATCGGTTCTGGANGCAGTCAGCANTACAAGTTGGGAAAGATGAGTTTCAAGCCTCT
JMSF052K21+ AAGCATCGGTTCTGGATGCAGTCAGCACTACAAGTTGAGAAAGATGAGTTTCAAGCCTCT
                      ____________________________________________________________
consensus AAGCATCGGTTCTGGATGCAGTCAGCACTACAAGTTGGGAAAGATGAGTTTCAAGCCTCT
 
. : . : . : . : . : . :
JMFS146D12+ CTTTGTTCTCCTCAACATTTGCTTTTACTGAAAGACTTCTCTCAGACTGAATCTGCTTCT
JMFS054E04+ NTTTGTTCTCCTCAACATTTGC
JMSF052K21+ CTTTGTTCTCCTCAACATTTGCTTTTACTGAAAGACTTCTCTCAGACTGAATCTGCTTCT
                      ____________________________________________________________
consensus CTTTGTTCTCCTCAACATTTGCTTTTACTGAAAGACTTCTCTCAGACTGAATCTGCTTCT
 
. : . : . : . : . : . :
JMFS146D12+ TCAATTGATTTATTCTGAGCATCAATGCTCTCACAGTATCGTTGCTGTGTTCTCCAGAGG
JMSF052K21+ TCAATTGATTTATTCTGAGCATCAATGCTCTCACAGTATCGTTGCTGTGTTCTCCAGAGG
                      ____________________________________________________________
consensus TCAATTGATTTATTCTGAGCATCAATGCTCTCACAGTATCGTTGCTGTGTTCTCCAGAGG
 
. : . : . : . : . : . :
JMFS146D12+ ATTTTCTGGATTTCGGAGAAGAATCGGATGAATTGGAGGACATGGCTGGCTGGCTGTGTT
JMSF052K21+ ATTTTCTGGATTTCGGAGAAGAATCGGATGAATTGGAGGACATGGCTGGCTGGCTGTGTT
                      ____________________________________________________________
consensus ATTTTCTGGATTTCGGAGAAGAATCGGATGAATTGGAGGACATGGCTGGCTGGCTGTGTT
 
. : . : . : . : . : . :
JMFS146D12+ CTCCAGCTGACGATGAGCTTCTTAAGTACAGCAAGAGACCGAGAAGAGAAGAGAAAGGGA
JMSF052K21+ CTCCAGCTGACGATGAGCTTCTTAAGTACAGCAAGAGACCGAGAAGAGAAGAGAAAGGGA
                      ____________________________________________________________
consensus CTCCAGCTGACGATGAGCTTCTTAAGTACAGCAAGAGACCGAGAAGAGAAGAGAAAGGGA
 
. : . : . : . : . : . :
JMFS146D12+ GGTCCTCCTACGGTCCTACCTCCTATCAAGAGAGATAACAAACAGTTGCCG
JMSF052K21+ GGTCCTCCTACGGTCCTACCTCCTATCAAGAGAGATAACAAACAGTTGCCGTATCAAGTC
                      ____________________________________________________________
consensus GGTCCTCCTACGGTCCTACCTCCTATCAAGAGAGATAACAAACAGTTGCCGTATCAAGTC