Previous Contig 008124:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005D24Sequence396008124 (2)
JMSF052K08Sequence646008124 (2)323011325 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052K08+ TGTTTAGAANCCAAATCATGAAACTGAAAGAGGGATCTGGTGAATT
                      ____________________________________________________________
consensus TGTTTAGAANCCAAATCATGAAACTGAAAGAGGGATCTGGTGAATT
 
. : . : . : . : . : . :
JMSF005D24+ CTGTAAAGATTGTTATCTCCATGTTTAC
JMSF052K08+ TTGCTTCAGCAGAGATTCAAGAAACCAAGAAACTGTAAAGATTGTTATCTCCATGTTTAC
                      ____________________________________________________________
consensus TTGCTTCAGCAGAGATTCAAGAAACCAAGAAACTGTAAAGATTGTTATCTCCATGTTTAC
 
. : . : . : . : . : . :
JMSF005D24+ AATATGAACAGCCCTGAATTCCAGAAACTAAAAGCATAATCTTCAATTCAACACAGAAAA
JMSF052K08+ AATATGAACAGCCCTGAATTCCAGAAACTAAAAGCATAATCTTCAATTCAACACAGAAAA
                      ____________________________________________________________
consensus AATATGAACAGCCCTGAATTCCAGAAACTAAAAGCATAATCTTCAATTCAACACAGAAAA
 
. : . : . : . : . : . :
JMSF005D24+ TCAAGAACCCAGATTATAAATTCTAGCAAATTGCAAAATATATTGGCTGCAGAGGTTTTT
JMSF052K08+ TCAAGAACCCNGATTATNAATTCTAGCAAATTGCAAAATATATTGGCTGCAGAGGTTTTT
                      ____________________________________________________________
consensus TCAAGAACCCAGATTATAAATTCTAGCAAATTGCAAAATATATTGGCTGCAGAGGTTTTT
 
. : . : . : . : . : . :
JMSF005D24+ TGAAGCATGGTAAATCATTGGTTGTGTTAGAATTGAGGTAGGAATCAAGAGAAGAAAAAA
JMSF052K08+ TGAAGCATGGTAAATCATTGGTTGTGTTAGAATTGAGGTAGGAATCAAGAGAAGAAAAAA
                      ____________________________________________________________
consensus TGAAGCATGGTAAATCATTGGTTGTGTTAGAATTGAGGTAGGAATCAAGAGAAGAAAAAA
 
. : . : . : . : . : . :
JMSF005D24+ AGTTCAGAATTTCAGATTCACTTCCAACATAATAATGAAGATTTACAAGACAACAAAAGT
JMSF052K08+ AGTTCAGAATTTCAGATTCACTTCCAACATAATAATGAAGATTTACAAGACAACAAAAGT
                      ____________________________________________________________
consensus AGTTCAGAATTTCAGATTCACTTCCAACATAATAATGAAGATTTACAAGACAACAAAAGT
 
. : . : . : . : . : . :
JMSF005D24+ ACTACAAGAGACAAGCTCTAATGAAGCTTCTTAGCTAACAGTGTCTACACCTACAAAGGA
JMSF052K08+ ACTACAAGAGACAAGCTCTAATGAAGCTTCTTAGCTAACAGTGTCTACACCTACAAAGGA
                      ____________________________________________________________
consensus ACTACAAGAGACAAGCTCTAATGAAGCTTCTTAGCTAACAGTGTCTACACCTACAAAGGA
 
. : . : . : . : . : . :
JMSF005D24+ TGTGCACATTCAAAACATCCTAGTACAAGCTAAGCAGCTGCCTCCTCCTTGCAAATCTCA
JMSF052K08+ TGTGCACATTCAAAACATCCTAGTACAAGCTAAGCAGCTGCCTCCTCCTTGCAAATCTCA
                      ____________________________________________________________
consensus TGTGCACATTCAAAACATCCTAGTACAAGCTAAGCAGCTGCCTCCTCCTTGCAAATCTCA
 
. : . : . : . : . : . :
JMSF005D24+ CA
JMSF052K08+ CATGGATTTCAAGAATGTTTTGCCATTAGCATAATAGCATTGGAAACAAGAGAATCCAAC
                      ____________________________________________________________
consensus CATGGATTTCAAGAATGTTTTGCCATTAGCATAATAGCATTGGAAACAAGAGAATCCAAC
 
. : . : . : . : . : . :
JMSF052K08+ ACACAGGACTAGCTCAAGTGGTCGACCACCGGACCTAAAGTGAGCACTTCAGCAGCAAGG
                      ____________________________________________________________
consensus ACACAGGACTAGCTCAAGTGGTCGACCACCGGACCTAAAGTGAGCACTTCAGCAGCAAGG
 
. : . : . : . : . : . :
JMSF052K08+ AGGGAGCTTGGGCCCTCGGGCTTCCTTGGGATTAGTGGTTGCGAGTTTCCCTCGTCACTC
                      ____________________________________________________________
consensus AGGGAGCTTGGGCCCTCGGGCTTCCTTGGGATTAGTGGTTGCGAGTTTCCCTCGTCACTC