Previous Contig 008121:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS126E01Sequence576008121 (3)gb:ATT6G21_15563130.045Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project).>gb:BT0149
JMSF012M14Sequence249008121 (3)695014017 (2)gb:AB109200_15268033e-46Oryza sativa (japonica cultivar-group) OsRFC1 mRNA for replication factor C 110
JMSF052J14Sequence631008121 (3)924014017 (2)gb:ATT6G21_15563134e-63Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project).>gb:BT0149

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS126E01+ GATCCTTC
JMSF052J14+ TTTGCTAGGTGTGATGTTAGCAGGATCCTTC
                      ____________________________________________________________
consensus TTTGCTAGGTGTGATGTTAGCAGGATCCTTC
 
. : . : . : . : . : . :
JMFS126E01+ CCCGGAGTAGGTAAGACAAAATCATCATCATCATCATCGCCCACAGCCTTGTGGGCTTTC
JMSF052J14+ CCCGGAGTAGGTAAGACAAAATCATCATCATCATCATCGCCCACAGCCTTGTGGGCTTTC
                      ____________________________________________________________
consensus CCCGGAGTAGGTAAGACAAAATCATCATCATCATCATCGCCCACAGCCTTGTGGGCTTTC
 
. : . : . : . : . : . :
JMFS126E01+ TTACCAGGGGGGGGCTTACCATGGCCAGATAATTCTTCACTGTCTCTTTGAGCCTTTCTC
JMSF052J14+ TTACCAGGGGGGGGCTTACCATGGCCAGATAATTCTTCACTGTCTCTTTGAGCCTTTCTC
                      ____________________________________________________________
consensus TTACCAGGGGGGGGCTTACCATGGCCAGATAATTCTTCACTGTCTCTTTGAGCCTTTCTC
 
. : . : . : . : . : . :
JMFS126E01+ TTGGAAGATAATTCCTCTACCTCCTTTTCTTCCTTTGCCTTACCTGTAGCAAAATACTTG
JMSF052J14+ TTGGAAGATAATTCCTCTACCTCCTTTTCTTCCTTTGCCTTACCTGTAGCAAAATACTTG
                      ____________________________________________________________
consensus TTGGAAGATAATTCCTCTACCTCCTTTTCTTCCTTTGCCTTACCTGTAGCAAAATACTTG
 
. : . : . : . : . : . :
JMSF012M14+ GTCCATCCAATTTCTCTGG-TTTGAAGAAGGT
JMFS126E01+ CTAGTTTTCCTTCTACCTGAACTTTCTTGTCCATCCAATTTCTCTGGTTTTGAAGAAGGT
JMSF052J14+ CTAGTTTTCCTTCTACCTGAACTTTCTTGTCCATCCAATTTCTCTGGTTTTGAAGAAGGT
                      ____________________________________________________________
consensus CTAGTTTTCCTTCTACCTGAACTTTCTTGTCCATCCAATTTCTCTGGTTTTGAAGAAGGT
 
. : . : . : . : . : . :
JMSF012M14+ TTATCCGATGCACTGGGCTTCGCAGAGTTTGAAGCATTACCATTGCCAGTACTTGTGTCA
JMFS126E01+ TTATCCGATGCACTGGGCTTCGCAGAGTTTGAAGCATTACCATTGCCAGTACTTGTGTCA
JMSF052J14+ TTATCCGATGCACTGGGCTTCGCAGAGTTTGAAGCATTACCATTGCCAGTACTTGTGTCA
                      ____________________________________________________________
consensus TTATCCGATGCACTGGGCTTCGCAGAGTTTGAAGCATTACCATTGCCAGTACTTGTGTCA
 
. : . : . : . : . : . :
JMSF012M14+ TGTTTCTTCATGAACCACTTTCTGATATCCGACATATCTGAAAGGAGTCACCGGGTTCAA
JMFS126E01+ TGTTTCTTCATGAACCACTTTCTGATATCCGACATATCTGAAAGGAGTCACCGGGTTCAA
JMSF052J14+ TGTTTCTTCATGAACCACTTTCTGATATCCGACATATCTGAAAGGAGTCACCGGGTTCAA
                      ____________________________________________________________
consensus TGTTTCTTCATGAACCACTTTCTGATATCCGACATATCTGAAAGGAGTCACCGGGTTCAA
 
. : . : . : . : . : . :
JMSF012M14+ TTGTCGATCTTTGTACAAAATGTTACTCGTCCAAGTAGTATACTAGTGCGATTCTACTAC
JMFS126E01+ TTGTCGATCTTTGTACAAAATGTTACTCGTCCAAGTAGTATACTAGTGCGATTCTACTAC
JMSF052J14+ TTGTCGATCTTTGTACAAAATGTTACTCGTCCAAGTAGTATACTAGTGCGATTCTACTAC
                      ____________________________________________________________
consensus TTGTCGATCTTTGTACAAAATGTTACTCGTCCAAGTAGTATACTAGTGCGATTCTACTAC
 
. : . : . : . : . : . :
JMSF012M14+ TGTGTAGCTATGAATTTTACCGCGGACGTTTCTC
JMFS126E01+ TGTGTAGCTATGAATTTTACCGCGGACGTTTCTCTGTGTCGCAGCTGAAGCGGAGAAAGG
JMSF052J14+ TGTGTAGCTATGAATTTTACCGCGGACGTTTCTCTGTGTCGCAGCTGAAGCGGAGAAAGG
                      ____________________________________________________________
consensus TGTGTAGCTATGAATTTTACCGCGGACGTTTCTCTGTGTCGCAGCTGAAGCGGAGAAAGG
 
. : . : . : . : . : . :
JMFS126E01+ GTTTTAATATCGGTTATTGGTTTAATGCGAAAGCGTATTCAAGCTACTAGGGGAAGAAGC
JMSF052J14+ GTTTTAATATCGGTTATTGGTTTAATGCGAAAGCGTATTCAAGCTACTAGGGGAAGAAGC
                      ____________________________________________________________
consensus GTTTTAATATCGGTTATTGGTTTAATGCGAAAGCGTATTCAAGCTACTAGGGGAAGAAGC
 
. : . : . : . : . : . :
JMFS126E01+ GCCATTTTCCATCAATGGCGAAATCAAG
JMSF052J14+ GCCATTTTCCATCAATGGCGAAATCAAGGGCTCAGGTTTTCGAAATGATTATAGCCGTCC
                      ____________________________________________________________
consensus GCCATTTTCCATCAATGGCGAAATCAAGGGCTCAGGTTTTCGAAATGATTATAGCCGTCC