Previous Contig 008115:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031C20Sequence564008115 (3)gb:AF424608_17989475e-37Arabidopsis thaliana At1g54990/F14C21_5 mRNA, complete cds.722011078 (4)gb:AF424608_17989472e-33Arabidopsis thaliana At1g54990/F14C21_5 mRNA, complete cds.
JMFF051F21Sequence556008115 (3)gb:AF424608_17989475e-37Arabidopsis thaliana At1g54990/F14C21_5 mRNA, complete cds.496011078 (4)gb:AF424608_17989470.014Arabidopsis thaliana At1g54990/F14C21_5 mRNA, complete cds.
JMSF052I13Sequence613008115 (3)gb:AF424608_17989476e-37Arabidopsis thaliana At1g54990/F14C21_5 mRNA, complete cds.919011078 (4)gb:AF424608_17989472e-52Arabidopsis thaliana At1g54990/F14C21_5 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031C20+ CTCT
JMSF052I13+ ATCCCCACTCTCT
                      ____________________________________________________________
consensus ATCCCCACTCTCT
 
. : . : . : . : . : . :
JMFF051F21+ CCACAACCACAGACTTATCTGAAAATCCCGACCCGGGCAGATCGATCGCAATTGCA
JMFF031C20+ TCCTCCACAACCACAGACTTATCTGAAAATCCCGACCCGGGCAGATCGATCGCAATTGCA
JMSF052I13+ TCCTCCACAACCACAGACTTATCTGAAAATCCCGACCCGGGCAGATCGATCGCAATTGCA
                      ____________________________________________________________
consensus TCCTCCACAACCACAGACTTATCTGAAAATCCCGACCCGGGCAGATCGATCGCAATTGCA
 
. : . : . : . : . : . :
JMFF051F21+ TGAACCCCTTTCTGACCTAACCACTTAACAATTTTCTGAAAGGCAAAAGTGCTGCACCCA
JMFF031C20+ TGAACCCCTTTCTGACCTAACCACTTAACAATTTTCTGAAAGGCAAAAGTGCTGCACCCA
JMSF052I13+ TGAACCCCTTTCTGACCTAACCACTTAACAATTTTCTGAAAGGCAAAAGTGCTGCACCCA
                      ____________________________________________________________
consensus TGAACCCCTTTCTGACCTAACCACTTAACAATTTTCTGAAAGGCAAAAGTGCTGCACCCA
 
. : . : . : . : . : . :
JMFF051F21+ AGCCCATGAACAATGAGAACATGGTCTGGTGACTTAATGGGCCCTTCTTGGATCGAAAAG
JMFF031C20+ AGCCCATGAACAATGAGAACATGGTCTGGTGACTTAATGGGCCCTTCTTGGATCGAAAAG
JMSF052I13+ AGCCCATGAACAATGAGAACATGGTCTGGTGACTTAATGGGCCCTTCTTGGATCGAAAAG
                      ____________________________________________________________
consensus AGCCCATGAACAATGAGAACATGGTCTGGTGACTTAATGGGCCCTTCTTGGATCGAAAAG
 
. : . : . : . : . : . :
JMFF051F21+ ACTTCAACTTGGGGGTGATTGAGCGCAGTCTGGACCTTGATGGTGCGGCCATTTGAATAG
JMFF031C20+ ACTTCAACTTGGGGGTGATTGAGCGCAGTCTGGACCTTGATGGTGCGGCCATTTGAATAG
JMSF052I13+ ACTTCAACTTGGGGGTGATTGAGCGCAGTCTGGACCTTGATGGTGCGGCCATTTGAATAG
                      ____________________________________________________________
consensus ACTTCAACTTGGGGGTGATTGAGCGCAGTCTGGACCTTGATGGTGCGGCCATTTGAATAG
 
. : . : . : . : . : . :
JMFF051F21+ TGGCGGCGCAGATTGGGAGGCAGGCTGAGGAACCAGGCCTTGGGGTCTTTAGGAGAGAAA
JMFF031C20+ TGGCGGCGCAGATTGGGAGGCAGGCTGAGGAACCAGGCCTTGGGGTCTTTAGGAGAGAAA
JMSF052I13+ TGGCGGCGCAGATTGGGAGGCAGGCTGAGGAACCAGGCCTTGGGGTCTTTAGGAGAGAAA
                      ____________________________________________________________
consensus TGGCGGCGCAGATTGGGAGGCAGGCTGAGGAACCAGGCCTTGGGGTCTTTAGGAGAGAAA
 
. : . : . : . : . : . :
JMFF051F21+ GAGGACAGAAAGATAAAGAATAGAGTGACGAGAGAGACTAGAACGGTGAAATAGAACCAG
JMFF031C20+ GAGGACAGAAAGATAAAGAATAGAGTGACGAGAGAGACTAGAACGGTGAAATAGAACCAG
JMSF052I13+ GAGGACAGAAAGATAAAGAATAGAGTGACGAGAGAGACTAGAACGGTGAAATAGAACCAG
                      ____________________________________________________________
consensus GAGGACAGAAAGATAAAGAATAGAGTGACGAGAGAGACTAGAACGGTGAAATAGAACCAG
 
. : . : . : . : . : . :
JMFF051F21+ AATTGAAATGGATTAGATGTATTCTTGGTGGTGGGGGAGGTCCGGGTAGAAGAAGGTGGA
JMFF031C20+ AATTGAAATGGATTAGATGTATTCTTGGTGGTGGGGGAGGTCCGGGTAGAAGAAGGTGGA
JMSF052I13+ AATTGAAATGGATTAGATGTATTCTTGGTGGTGGGGGAGGTCCGGGTAGAAGAAGGTGGA
                      ____________________________________________________________
consensus AATTGAAATGGATTAGATGTATTCTTGGTGGTGGGGGAGGTCCGGGTAGAAGAAGGTGGA
 
. : . : . : . : . : . :
JMFF051F21+ GGAGTGCGGGGTTTAGGGGGTGGTGAAGTGCGGGCTTTAGGTGGTGGGGTGGGTGAATCT
JMFF031C20+ GGAGTGCGGGGTTTAGGGGGTGGTGAAGTGCGGGCTTTAGGTGGTGGGGTGGGTGAATCT
JMSF052I13+ GGAGTGCGGGGTTTAGGGGGTGGTGAAGTGCGGGCTTTAGGTGGTGGGGTGGGTGAATCT
                      ____________________________________________________________
consensus GGAGTGCGGGGTTTAGGGGGTGGTGAAGTGCGGGCTTTAGGTGGTGGGGTGGGTGAATCT
 
. : . : . : . : . : . :
JMFF051F21+ GGTTCTTCAGTTATGATCGCCATTGTAATGCTGGTGATTGCTGGAGTGTATTGGCATGAG
JMFF031C20+ GGTTCTTCAGTTATGATCGCCATTGTAATGCTGGTGATTGCTGGAGTGTATTGGCATGAG
JMSF052I13+ GGTTCTTCAGTTATGATCGCCATTGTAATGCTGGTGATTGCTGGAGTGTATTGGCATGAG
                      ____________________________________________________________
consensus GGTTCTTCAGTTATGATCGCCATTGTAATGCTGGTGATTGCTGGAGTGTATTGGCATGAG
 
. : . : . : . : . : . :
JMFF051F21+ CTCTGATCAAGACTGAAGGT
JMFF031C20+ CTCTGATCAAGACTGAAGGT
JMSF052I13+ CTCTGATCAAGACTGAAGGTAAAGATTCGTGGGATGAAGGCCTGCACTATGAAAAAGGCC
                      ____________________________________________________________
consensus CTCTGATCAAGACTGAAGGTAAAGATTCGTGGGATGAAGGCCTGCACTATGAAAAAGGCC