Previous Contig 008095:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS002H11Sequence440008095 (25)gb:AF306345_17844982e-22Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS016B01Sequence542008095 (25)gb:AF306345_17844983e-58Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS020E07Sequence626008095 (25)gb:AF306345_17844981e-48Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS037D06Sequence500008095 (25)gb:AF306345_17844982e-46Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS043E02Sequence625008095 (25)gb:AF306345_17844983e-31Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS043F12Sequence571008095 (25)gb:AF306345_17844983e-45Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS048F06Sequence584008095 (25)gb:AF306345_17844983e-39Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS049G07Sequence599008095 (25)gb:AF306345_17844982e-58Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS055G04Sequence621008095 (25)gb:AF306345_17844986e-33Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS086E05Sequence638008095 (25)gb:AF306345_17844989e-64Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS092D11Sequence612008095 (25)gb:AF306345_17844983e-39Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS093D07Sequence607008095 (25)gb:AF306345_17844984e-58Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS119C08Sequence612008095 (25)gb:AF306345_17844981e-59Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS137C05Sequence604008095 (25)gb:AF306345_17844985e-37Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS141F05Sequence612008095 (25)gb:AF306345_17844982e-43Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS150B12Sequence597008095 (25)gb:AF306345_17844981e-50Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS155B04Sequence626008095 (25)gb:AF306345_17844981e-28Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS159G04Sequence461008095 (25)gb:AF306345_17844982e-39Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS160A03Sequence326008095 (25)gb:AF306345_17844989e-21Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMFS162D03Sequence554008095 (25)gb:AF306345_17844982e-53Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara
JMSF002F22Sequence271008095 (25)gb:AF306345_17844982e-11Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara755012352 (5)gb:AY138252_15822813e-74Gossypium hirsutum phospholipase D delta isoform 1a mRNA, complete cds.
JMSF024E14Sequence635008095 (25)gb:AF306345_17844983e-60Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara776012352 (5)gb:AY138252_15822812e-72Gossypium hirsutum phospholipase D delta isoform 1a mRNA, complete cds.
JMSF027L19Sequence635008095 (25)gb:AF306345_17844983e-60Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara704012352 (5)gb:AY138252_15822814e-71Gossypium hirsutum phospholipase D delta isoform 1a mRNA, complete cds.
JMSF028E04Sequence672008095 (25)gb:AF306345_17844988e-66Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara750012352 (5)gb:AY138252_15822814e-73Gossypium hirsutum phospholipase D delta isoform 1a mRNA, complete cds.
JMSF052C23Sequence599008095 (25)gb:AF306345_17844987e-25Arabidopsis thaliana phospholipase D mRNA, complete cds.>gb:AF322228_1786102 Ara952012352 (5)gb:AF544228_1810453e-110Gossypium hirsutum phospholipase D delta isoform (pldd) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS049G07+ CGTGT
JMFS086E05+ GCGCTTTACGCCCAGATTCTGAGGATCTCCGGCAATGCCGTGT
JMSF028E04+ GGAAATATGTGCGCTTTACGCCCAGATTCTGAGGATCTCCGGCAATGCCGTGT
JMSF027L19+ TCCGGCAATGCCGTGT
JMFS119C08+ CCGGCAATGCCGTGT
JMFS093D07+ CCGGCAATGCCGTGT
JMSF024E14+ TCCGGCAATGCCGTGT
                      ____________________________________________________________
consensus GGAAATATGTGCGCTTTACGCCCAGATTCTGAGGATCTCCGGCAATGCCGTGT
 
. : . : . : . : . : . :
JMFS016B01+ GATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMFS049G07+ TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMFS086E05+ TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMSF028E04+ TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMSF027L19+ TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMFS119C08+ TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMFS093D07+ TANTAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
JMFS162D03+ CGTGTCC
JMFS043F12+ GATTTCAATTCTGAGAGCCGTGTCN
JMSF024E14+ TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
                      ____________________________________________________________
consensus TTATAGTAGGGATCAGATTCGAAGGGGGTGAACTTGATTTCAATTCTGAGAGCCGTGTCC
 
. : . : . : . : . : . :
JMFS016B01+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS037D06+ AAGCACCAGGAACCACCCGG-AGATTTGTTCCCC
JMFS049G07+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS086E05+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMSF028E04+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMSF027L19+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS119C08+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS093D07+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS162D03+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS043F12+ GCCTTT-TAGGCTTCCCGGAGGAGCCTTGCACCGGTAACCATCCGG-AGATTTGTTCCTC
JMSF024E14+ GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
JMFS150B12+ GGAGGCTTCCCGGAGGAGCCAAGCACGGGGAACCACCCGG-AGATTTGTTCCCC
JMFS141F05+ CCGGGAACCACCCCGNAGATTTGTTCCCC
JMFS020E07+ CGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCNCC
                      ____________________________________________________________
consensus GCCTTTGGAGGCTTCCCGGAGGAGCCAAGCACCGGGAACCACCCGG-AGATTTGTTCCCC
 
. : . : . : . : . : . :
JMFS016B01+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS037D06+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS049G07+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS086E05+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMSF028E04+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMSF027L19+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS119C08+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS093D07+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS162D03+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS043F12+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCTGTTAACGTC
JMSF024E14+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS150B12+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS141F05+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS159G04+ CCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS020E07+ GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS137C05+ GCCGGGATTTTCACTTTGCCCATAATCTGAGCTCAGAAAACGTC
JMFS048F06+ CGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS092D11+ TCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
JMFS055G04+ GTC
                      ____________________________________________________________
consensus GGAAGCAATCCTCTTCGCCGGGATTTTCACTTTGCCCATAATCTGAGCTCCGAAAACGTC
 
. : . : . : . : . : . :
JMFS016B01+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS037D06+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS049G07+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS086E05+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMSF028E04+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMSF027L19+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS119C08+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS093D07+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS162D03+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS043F12+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMSF024E14+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS150B12+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS141F05+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS159G04+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS020E07+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS137C05+ GTGTCCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS048F06+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS092D11+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS055G04+ GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS043E02+ TAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
JMFS155B04+ TCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
                      ____________________________________________________________
consensus GTTGTCCTTAACCCGGAACTCCAAATCGACCATGGGATGAGCCAAGGGGATGTCGAATCT
 
. : . : . : . : . : . :
JMFS016B01+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS037D06+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS049G07+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS086E05+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMSF028E04+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMSF027L19+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS119C08+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS093D07+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS162D03+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS043F12+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTT
JMSF024E14+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS150B12+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS141F05+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS159G04+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS002H11+ AAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS160A03+ TGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS020E07+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS137C05+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS048F06+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS092D11+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS055G04+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS043E02+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
JMFS155B04+ CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTNTG
JMSF052C23+ TCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
                      ____________________________________________________________
consensus CTCGTCCCACAAAGGGTTCTGCGAGTTGGGTATGACCCGAGTCCGAGCAAGTGTAGTTTG
 
. : . : . : . : . : . :
JMFS016B01+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS037D06+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS049G07+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS086E05+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMSF028E04+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMSF027L19+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS119C08+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS093D07+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS162D03+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS043F12+ CGGTGCCTACTCCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMSF024E14+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS150B12+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS141F05+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS159G04+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTTTTCAC
JMFS002H11+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTNTTCAC
JMFS160A03+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS020E07+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS137C05+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS048F06+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS092D11+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS055G04+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS043E02+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMFS155B04+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
JMSF052C23+ CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
                      ____________________________________________________________
consensus CGGCGCCGACACCGTAACATAAGGGTCACTAGTTATAATCCCCCGGCGGTAGGTCTTCAC
 
. : . : . : . : . : . :
JMFS016B01+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS037D06+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS049G07+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS086E05+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMSF028E04+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMSF027L19+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS119C08+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS093D07+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS162D03+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS043F12+ CTCCTCCTCCTCTTCCTCCGGTTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMSF024E14+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS150B12+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS141F05+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS159G04+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS002H11+ CTCCTCCTCCTCCTCCTCCGGNTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS160A03+ CTCCTCCTCCTCCTCCTCCGGNTCCTCCTTGCCGTTGAACTCGCCCCTCGGCCGCCGGCA
JMSF002F22+ CTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS020E07+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS137C05+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS048F06+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS092D11+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS055G04+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS043E02+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMFS155B04+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
JMSF052C23+ CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
                      ____________________________________________________________
consensus CTCCTCCTCCTCCTCCTCCGGCTCCTCCTTGCCGTTGAACTCGTCACTCGGCCGCCGGCA
 
. : . : . : . : . : . :
JMFS016B01+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS037D06+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS049G07+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS086E05+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMSF028E04+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMSF027L19+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS119C08+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS093D07+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS162D03+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS043F12+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMSF024E14+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS150B12+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS141F05+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS159G04+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS002H11+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS160A03+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMSF002F22+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS020E07+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS137C05+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS048F06+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS092D11+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS055G04+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACAT
JMFS043E02+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMFS155B04+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
JMSF052C23+ GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
                      ____________________________________________________________
consensus GGCGTCGCAAGTGAAGCAGCGGCGGAGGCGCTCGGATGTCAAGTCCATGTTGGGCAACTT
 
. : . : . : . : . : . :
JMFS016B01+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS037D06+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS049G07+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS086E05+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMSF028E04+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMSF027L19+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS119C08+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS093D07+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS162D03+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS043F12+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMSF024E14+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS150B12+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS141F05+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS159G04+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS002H11+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS160A03+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMSF002F22+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS020E07+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS137C05+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS048F06+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS092D11+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS055G04+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS043E02+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMFS155B04+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
JMSF052C23+ ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
                      ____________________________________________________________
consensus ACGCGCCTCAATGATGTGCAGCTCCAAATCCCCGTGCAAGTACACAATCTCCTCCCCTGA
 
. : . : . : . : . : . :
JMFS016B01+ TTTCTCCGCCATC
JMFS037D06+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCG
JMFS049G07+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGA
JMFS086E05+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGAC
JMSF028E04+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMSF027L19+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS119C08+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTA
JMFS093D07+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTA
JMFS162D03+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS043F12+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMSF024E14+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS150B12+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS141F05+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS159G04+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTA
JMFS002H11+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS160A03+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAAC
JMSF002F22+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS020E07+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS137C05+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS048F06+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS092D11+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS055G04+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS043E02+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMFS155B04+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
JMSF052C23+ TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
                      ____________________________________________________________
consensus TTTCTCCGCCATCGTCTTCTGCTCTCTCGCCGGATTTTCAAGAACCGGTAGTAGACTACT
 
. : . : . : . : . : . :
JMSF028E04+ CCTCAAAACTCCAACC
JMSF027L19+ CCTCAAAACTCCAACCTAC
JMFS162D03+ CCTCAAAA
JMFS043F12+ CCTCAAAA
JMSF024E14+ CCTCAAAACTCCAACCTAC
JMFS150B12+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS141F05+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS002H11+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMSF002F22+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTC
JMFS020E07+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS137C05+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS048F06+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS092D11+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS055G04+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS043E02+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMFS155B04+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
JMSF052C23+ CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
                      ____________________________________________________________
consensus CCTCAAAACTCCAACCTACACCATCTACGGATCTACCCAGTCTATAATATACCATTTACA
 
. : . : . : . : . : . :
JMFS150B12+ GCAA
JMFS141F05+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGA
JMFS002H11+ GCAAAGAACAAACCTTCATTTTCAAGAAAT
JMFS020E07+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGA
JMFS137C05+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCCT
JMFS048F06+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCC
JMFS092D11+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCCT
JMFS055G04+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAGTTGAGAAGAAATCCAAATCCT
JMFS043E02+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCCT
JMFS155B04+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCCT
JMSF052C23+ GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCCT
                      ____________________________________________________________
consensus GCAAAGAACAAACCTTCATTTTCAAGAAATTAGCTGGAATTGAGAAGAAATCCAAATCCT
 
. : . : . : . : . : . :
JMFS137C05+ TGGAGGCCCCGCAAAGAAGA
JMFS092D11+ TGGAGGCCCCGCAAAGAAGACAATAA
JMFS055G04+ TGGAGGCCCCGCAAAGAAGACAATAATTATGTAGAATGATAGCAGTTAGAGAGTAGAGTA
JMFS043E02+ TGGAGGCCCCGCAAAGAAGACAATAATTATGTAGAATGATAGCAGTTAGAGAGTAGAGTA
JMFS155B04+ TGGAGGCCCCGCAAAGAAGACAATAATTATGTAGAATGATAGCAGTTAGAGAGTAGAGTA
JMSF052C23+ TGGAGGCCCCGCAAAGAAGACAATAATTATGTAGAATGATAGCAGTTAGAGAGTAGAGTA
                      ____________________________________________________________
consensus TGGAGGCCCCGCAAAGAAGACAATAATTATGTAGAATGATAGCAGTTAGAGAGTAGAGTA
 
. : . : . : . : . : . :
JMFS055G04+ GTGGGTGACGCGGTTGTA
JMFS043E02+ GTGGGTGACGCGGTTGTAGTTGCCCCGCTCACG
JMFS155B04+ GTGGGTGACGCGGTTGTAGTTGCCCCGCTCACGTGGGAAACACCG
JMSF052C23+ GTGGGTGACGCGGTTGTAGTTGCCCCGCTCACGTGGGAAACACCGAAACTCCTTCTTTCC
                      ____________________________________________________________
consensus GTGGGTGACGCGGTTGTAGTTGCCCCGCTCACGTGGGAAACACCGAAACTCCTTCTTTCC