Previous Contig 008093:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019D08Sequence567008093 (15)gb:AF216497_17780857e-72Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.743013697 (3)gb:AF216497_1778085e-107Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS008D09Sequence625008093 (15)pir|B86240|B862403e-37protein F20B24.12 [imported] - Arabidopsis thaliana>gb:AE005172_890081 Arabidops
JMFS009A04Sequence612008093 (15)gb:AF216497_17780853e-90Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS010B05Sequence591008093 (15)gb:AF216497_17780853e-85Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS015G08Sequence247008093 (15)
JMFS036E07Sequence340008093 (15)gb:AF216497_17780853e-46Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS052C02Sequence482008093 (15)gb:AF216497_17780851e-61Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS061C07Sequence606008093 (15)gb:AF216497_17780858e-77Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS096A10Sequence624008093 (15)pir|B86240|B862405e-38protein F20B24.12 [imported] - Arabidopsis thaliana>gb:AE005172_890081 Arabidops
JMFS098G08Sequence627008093 (15)gb:AF216497_17780853e-42Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS099E06Sequence609008093 (15)pir|B86240|B862404e-34protein F20B24.12 [imported] - Arabidopsis thaliana>gb:AE005172_890081 Arabidops
JMFS100E10Sequence618008093 (15)gb:AF216497_17780851e-40Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMFS101G10Sequence610008093 (15)gb:AF216497_17780853e-97Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMSF047C13Sequence682008093 (15)gb:AF216497_17780851e-45Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.761013697 (3)gb:AF216497_1778085e-107Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMSF052C15Sequence672008093 (15)gb:AF216497_17780851e-43Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.896013697 (3)gb:AF216497_1778085e-128Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS036E07+ TATTGCACGAGAGATTGCAATTCTTTGCTTTTGTCCTCCAGATAATTGTA
JMFS061C07+ CACTATTGCACGAGAGATTGCAATTCTTGCTTTTTGTCCTCCAGATAATTGTA
                      ____________________________________________________________
consensus CACTATTGCACGAGAGATTGCAATTCTTTGTTTTTGTCCTCCAGATAATTGTA
 
. : . : . : . : . : . :
JMFS036E07+ CCCCTCTCTCACCCACCTGAGTTTCAAACCTGTCAGGGAGGTTGTTGATGAAGGTGATTG
JMFS061C07+ CCCCTCTCTCACCCACCTGAGTTTCAAACCTGTCAGGGAGGTTGTTGATGAAGGTGATTG
                      ____________________________________________________________
consensus CCCCTCTCTCACCCACCTGAGTTTCAAACCTGTCAGGGAGGTTGTTGATGAAGGTGATTG
 
. : . : . : . : . : . :
JMFS036E07+ CCCCAGAAAGTTTTGTGGCATGTGCAATTTCATCAGGGGTAGCATCCTCTTTTCCATACA
JMFS061C07+ CCCCAGAAAGTTTTGTGGCATGTGCAATTTCATCAGGGGTAGCATCCTCTTTTCCATACA
                      ____________________________________________________________
consensus CCCCAGAAAGTTTTGTGGCATGTGCAATTTCATCAGGGGTAGCATCCTCTTTTCCATACA
 
. : . : . : . : . : . :
JMFS036E07+ GAATATTCTCCCTTATGGTTGTGGCAAAAAGGGCAGGTTCTTGATTAACCAATCCAATTT
JMFS061C07+ GAATATTCTCCCTTATGGTTGTGGCAAAAAGGGCAGGTTCTTGATTAACCAATCCAATTT
                      ____________________________________________________________
consensus GAATATTCTCCCTTATGGTTGTGGCAAAAAGGGCAGGTTCTTGATTAACCAATCCAATTT
 
. : . : . : . : . : . :
JMFS036E07+ GTTGCCTAAGCCACTTGACCTCAAGTTCACTGCTCTCAACTCCATCCAATAGTATCTGCC
JMFS061C07+ GTTGCCTAAGCCACTTGACCTCAAGTTCACTGCTCTCAACTCCATCCAATAGTATCTGCC
JMFS052C02+ TCCATCCAATAGTATCTGCC
                      ____________________________________________________________
consensus GTTGCCTAAGCCACTTGACCTCAAGTTCACTGCTCTCAACTCCATCCAATAGTATCTGCC
 
. : . : . : . : . : . :
JMFS036E07+ CAGAATTAGGCTCATAGAACCGTTCAATCAAGGACACAACAGTGCTCTTC
JMFS061C07+ CAGAATTAGGCTCATAGAACCGTTCAATCAAGGACACAACAGTGCTCTTCCCTGATCCAC
JMFS052C02+ CAGAATTAGGCTCATAGAACCGTTCAATCAAGGACACAACAGTGCTCTTCCCTGATCCAC
JMFF019D08+ GATCCAC
                      ____________________________________________________________
consensus CAGAATTAGGCTCATAGAACCGTTCAATCAAGGACACAACAGTGCTCTTCCCTGATCCAC
 
. : . : . : . : . : . :
JMFS061C07+ TCCCTCCTACTAGGGCTACAATCTTCCCCGGGGGGATATCGAGACACAGCTTGTCAAAGA
JMFS052C02+ TCCCTCCTACTAGGGCTACAATCTTCCCCGGGGGGATATCGAGACACAGCTTGTCAAAGA
JMFF019D08+ TCCCTCCTACTAGGGCTACAATCTTCCCCGGGGGGATATCGAGACACAGCTTGTCAAAGA
                      ____________________________________________________________
consensus TCCCTCCTACTAGGGCTACAATCTTCCCCGGGGGGATATCGAGACACAGCTTGTCAAAGA
 
. : . : . : . : . : . :
JMFS061C07+ TCAACACATCCGGGCGAGATGGGTAACTAAAACACACATCCTTGAATTCGATGTGCCCGT
JMFS052C02+ TCAACACATCCGGGCGAGATGGGTAACTAAAACACACATCCTTGAATTCGATGTGCCCGT
JMFF019D08+ TCAACACATCCGGGCGAGATGGGTAACTAAAACACACATCCTTGAATTCGATGTGCCCGT
                      ____________________________________________________________
consensus TCAACACATCCGGGCGAGATGGGTAACTAAAACACACATCCTTGAATTCGATGTGCCCGT
 
. : . : . : . : . : . :
JMFS061C07+ CTAGTTGATTCAGTTTCCTTCCTCCGCTCCTTGAGCTGTTGGTTTTGTTTGCTGTGTTTC
JMFS052C02+ CTAGTTGATTCAGTTTCCTTCCTCCGCTCCTTGAGCTGTTGGTTTTGTTTGCTGTGTTTC
JMFF019D08+ CTAGTTGATTCAGTTTCCTTCCTCCGCTCCTTGAGCTGTTGGTTTTGTTTGCTGTGTTTC
                      ____________________________________________________________
consensus CTAGTTGATTCAGTTTCCTTCCTCCGCTCCTTGAGCTGTTGGTTTTGTTTGCTGTGTTTC
 
. : . : . : . : . : . :
JMFS061C07+ TCTCGATCATCTCGAATATGGGATAAGCAGCCGCCTTCGCTCGGATAAAAGCTGAAACAT
JMFS052C02+ TCTCGATCATCTCGAATATGGGATAAGCAGCCGCCTTCGCTCGGATAAAAGCTGAAACAT
JMFF019D08+ TCTCGATCATCTCGAATATGGGATAAGCAGCCGCCTTCGCTCGGATAAAAGCTGAAACAT
                      ____________________________________________________________
consensus TCTCGATCATCTCGAATATGGGATAAGCAGCCGCCTTCGCTCGGATAAAAGCTGAAACAT
 
. : . : . : . : . : . :
JMFS061C07+ CCGGTGCTGCCTG
JMFS052C02+ CCGGTGCTGCCTGCCCCAGTGACAGGCCAGCAATGACAACATTAAGCATGGTGGTAAAAG
JMFF019D08+ CCGGTGCTGCCTGCCCCAGTGACAGGCCAGCAATGACAACATTAAGCATGGTGGTAAAAG
                      ____________________________________________________________
consensus CCGGTGCTGCCTGCCCCAGTGACAGGCCAGCAATGACAACATTAAGCATGGTGGTAAAAG
 
. : . : . : . : . : . :
JMFS052C02+ AGTCCCCTCCATTGGCAATGTTCTTATGGACAACTATGCTAGTGAACCACACAAGCAAGG
JMFF019D08+ AGTCCCCTCCATTGGCAATGTTCTTATGGACAACTATGCTAGTGAACCACACAAGCAAGG
JMFS010B05+ CTATGCTAGTGAACCACACAAGCAAGG
                      ____________________________________________________________
consensus AGTCCCCTCCATTGGCAATGTTCTTATGGACAACTATGCTAGTGAACCACACAAGCAAGG
 
. : . : . : . : . : . :
JMFS052C02+ ACCAAGAAAGGAAAAGGACACAATGCAAGGTGCCCAAT
JMFF019D08+ ACCAAGAAAGGAAAAGGACACAATGCAAGGTGCCCAATCCGAGCCCTTTGGCTAGCCCTG
JMFS010B05+ ACCAAGAAAGGAAAAGGACACAATGCAAGGTGCCCAATCCGAGCCCTTTGGCTAGCCCTG
JMFS009A04+ GCCCAATCCGAGCCCTTTGGCTAGCCCTG
                      ____________________________________________________________
consensus ACCAAGAAAGGAAAAGGACACAATGCAAGGTGCCCAATCCGAGCCCTTTGGCTAGCCCTG
 
. : . : . : . : . : . :
JMFF019D08+ CCTTCTTTCCATATTTGTATGTGTTCAGTAATGCCTCTGTGTATGACTTCACCGCCTTCT
JMFS010B05+ CCTTCTTTCCATATTTGTATGTGTTCAGTAATGCCTCTGTGTATGACTTCACCGCCTTCT
JMFS009A04+ CCTTCTTTCCATATTTGTATGTGTTCAGTAATGCCTCTGTGTATGACTTCACCGCCTTCT
                      ____________________________________________________________
consensus CCTTCTTTCCATATTTGTATGTGTTCAGTAATGCCTCTGTGTATGACTTCACCGCCTTCT
 
. : . : . : . : . : . :
JMFF019D08+ CTTCTCCGGTAAACGCTTGCACTGTTCTGACATTACCGACCACCTCTTGGGCGATTTCAC
JMFS010B05+ CTTCTCCGGTAAACGCTTGCACTGTTCTGACATTACCGACCACCTCTTGGGCGATTTCAC
JMFS009A04+ CTTCTCCGGTAAACGCTTGCACTGTTCTGACATTACCGACCACCTCTTGGGCGATTTCAC
JMFS101G10+ GGTAAACGCTTGCACTGTTCTGACATTACCGACCACCTCTTGGGCGATTTCAC
                      ____________________________________________________________
consensus CTTCTCCGGTAAACGCTTGCACTGTTCTGACATTACCGACCACCTCTTGGGCGATTTCAC
 
. : . : . : . : . : . :
JMFF019D08+ CGGCTCTAACATAGGACT
JMFS010B05+ CGGCTCTAACATAGGACTTGCGAACTCTGGCGATTAGGCCGGTGGCGACGAAGGCGTAGA
JMFS009A04+ CGGCTCTAACATAGGACTTGCGAACTCTGGCGATTAGGCCGGTGGCGACGAAGGCGTAGA
JMFS101G10+ CGGCTCTAACATAGGACTTGCGAACTCTGGCGATTAGGCCGGTGGCGACGAAGGCGTAGA
                      ____________________________________________________________
consensus CGGCTCTAACATAGGACTTGCGAACTCTGGCGATTAGGCCGGTGGCGACGAAGGCGTAGA
 
. : . : . : . : . : . :
JMFS010B05+ CTCCGCCGGCGAGAGCTATGAGGGGGACAATGGAGAGGGTGACCAAGCTGATTTGCCACA
JMFS009A04+ CTCCGCCGGCGAGAGCTATGAGGGGGACAATGGAGAGGGTGACCAAGCTGATTTGCCACA
JMFS101G10+ CTCCGCCGGCGAGAGCTATGAGGGGGACAATGGAGAGGGTGACCAAGCTGATTTGCCACA
                      ____________________________________________________________
consensus CTCCGCCGGCGAGAGCTATGAGGGGGACAATGGAGAGGGTGACCAAGCTGATTTGCCACA
 
. : . : . : . : . : . :
JMFS010B05+ ACCTTATGAAACCTATTGTGAATCCTGCTATGAACCTGCTTATGTAGTGCATGAAATTTC
JMFS009A04+ ACCTTATGAAACCTATTGTGAATCCTGCTATGAACCTGCTTATGTAGTGCATGAAATTTC
JMFS101G10+ ACCTTATGAAACCTATTGTGAATCCTGCTATGAACCTGCTTATGTAGTGCATGAAATTTC
                      ____________________________________________________________
consensus ACCTTATGAAACCTATTGTGAATCCTGCTATGAACCTGCTTATGTAGTGCATGAAATTTC
 
. : . : . : . : . : . :
JMFS010B05+ CCACCTTCTCAGAGATGGCATCTTGAACTACAATAATGTCAGTAGTAATTGCAGAAATGA
JMFS009A04+ CCACCTTCTCAGAGATGGCATCTTGAACTACAATAATGTCAGTAGTAATTGCAGAAATGA
JMFS101G10+ CCACCTTCTCAGAGATGGCATCTTGAACTACAATAATGTCAGTAGTAATTGCAGAAATGA
                      ____________________________________________________________
consensus CCACCTTCTCAGAGATGGCATCTTGAACTACAATAATGTCAGTAGTAATTGCAGAAATGA
 
. : . : . : . : . : . :
JMFS010B05+ CTTCTCCAGTTGAAGCTTCAGTATCAAAAAGACTAATGTCTTGATTCAACATAGACCTCA
JMFS009A04+ CTTCTCCAGTTGAAGCTTCAGTATCAAAAAGACTAATGTCTTGATTCAACATAGACCTCA
JMFS101G10+ CTTCTCCAGTTGAAGCTTCAGTATCAAAAAGACTAATGTCTTGATTCAACATAGACCTCA
JMFS098G08+ GACCTCA
JMSF047C13+ GTCTTGATTCAACATAGACCTCA
JMSF052C15+ TTCAACATAGACCTCA
                      ____________________________________________________________
consensus CTTCTCCAGTTGAAGCTTCAGTATCAAAAAGACTAATGTCTTGATTCAACATAGACCTCA
 
. : . : . : . : . : . :
JMFS010B05+ AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMFS009A04+ AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMFS101G10+ AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMFS100E10+ TATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMFS098G08+ AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMFS096A10+ CGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMFS099E06+ TGTGCATCCAACATGCCACCT
JMFS008D09+ CGCCGCTTGCCTCTCTNCGGTGTGCATCCAACATGCCACCT
JMSF047C13+ AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
JMSF052C15+ AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
                      ____________________________________________________________
consensus AATATGCCATTCTCATCTTCGCCGCTTGCCTCTCTCCGGTGTGCATCCAACATGCCACCT
 
. : . : . : . : . : . :
JMFS010B05+ CTGTCCATGATGAAAAGAGTATGA
JMFS009A04+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMFS101G10+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMFS100E10+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMFS098G08+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMFS096A10+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMFS099E06+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMFS008D09+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMSF047C13+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
JMSF052C15+ CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
                      ____________________________________________________________
consensus CTGTCCATGATGAAAAGAGTATGACGATACTTAAGTAAACAAAATCCAAGGAGTACTTGG
 
. : . : . : . : . : . :
JMFS009A04+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCC
JMFS101G10+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMFS100E10+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMFS098G08+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMFS096A10+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMFS099E06+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMFS008D09+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMSF047C13+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
JMSF052C15+ CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
                      ____________________________________________________________
consensus CAACTTTATGGGAAGCTTCTGCCGGGAAAAGAAAAGCCTCCCCAATCACATCTATAATTT
 
. : . : . : . : . : . :
JMFS101G10+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMFS100E10+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMFS098G08+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMFS096A10+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMFS099E06+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMFS008D09+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMSF047C13+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
JMSF052C15+ TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
                      ____________________________________________________________
consensus TGCCGAAGAAAACAAAGAAGACAGGGACAGAAGCCCCATGCACACAGGCGCCAACAAATC
 
. : . : . : . : . : . :
JMFS101G10+ CGACAAACATCAGAA
JMFS100E10+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
JMFS098G08+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
JMFS096A10+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
JMFS099E06+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
JMFS008D09+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
JMSF047C13+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
JMSF052C15+ CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
                      ____________________________________________________________
consensus CGACAAACATCAGAACATAGTCCACACCATCGGCGAAGGAGAACAGTTTCATTAATGACA
 
. : . : . : . : . : . :
JMFS100E10+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
JMFS098G08+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
JMFS096A10+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
JMFS099E06+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
JMFS015G08+ GGTT
JMFS008D09+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
JMSF047C13+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
JMSF052C15+ CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGC---CGGTT
                      ____________________________________________________________
consensus CTTTCTTAACTGCTTTCCTCCTCTCATTTTCCTCCTCCTCCTCCTTCTCCGCCGGCGGTT
 
. : . : . : . : . : . :
JMFS100E10+ TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMFS098G08+ TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMFS096A10+ TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMFS099E06+ TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMFS015G08+ TCTTGCCGCCGGGAAACGCTGTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMFS008D09+ TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMSF047C13+ TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
JMSF052C15+ TCTCGCCGCCGGGAAAGGCTCTCCGGTTGTCCATTTAGAGCAAA-AAAGATTACAGGTAT
                      ____________________________________________________________
consensus TCTCGCCGCCGGGAAACGCTCTCCGGTTGTCCATTTAGAGCAAAGAAAGATTACAGGTAT
 
. : . : . : . : . : . :
JMFS100E10+ GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMFS098G08+ GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMFS096A10+ GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMFS099E06+ GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMFS015G08+ GATAGCCGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMFS008D09+ GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMSF047C13+ GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
JMSF052C15+ GATAGATGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
                      ____________________________________________________________
consensus GATAGACGGCCGGGGTTACAGGATAATCGAAGATAAATATAATGGCTAAGTAGATGAGAT
 
. : . : . : . : . : . :
JMFS100E10+ GATGATATATAGTTGTGGTAAGCAGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
JMFS098G08+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
JMFS096A10+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
JMFS099E06+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
JMFS015G08+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGGCGACAAGTGA
JMFS008D09+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
JMSF047C13+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
JMSF052C15+ GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
                      ____________________________________________________________
consensus GATGATATATAGTTGTGGTAAGCCGTGAGGTAAGGTTTGTTGACTAAAGACGACAAGTGA
 
. : . : . : . : . : . :
JMFS100E10+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
JMFS098G08+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
JMFS096A10+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
JMFS099E06+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
JMFS015G08+ GATGGGGTATGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGACAAGATCAGAGAGG
JMFS008D09+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
JMSF047C13+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
JMSF052C15+ GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
                      ____________________________________________________________
consensus GATGGGGTCTGGAAGAGTGGCGGTTGTTAGTCGAATAGTCGCCGGAGAAGATCAGAGAGG
 
. : . : . : . : . : . :
JMFS100E10+ TAGAATATATATATATAATC
JMFS098G08+ TAGAATATATATATATAATC
JMFS096A10+ TAGAATATATATATATAATCGTCGTCTTTTTTGGTATAGTTTG
JMFS099E06+ TAGAATATATATATATAATCGTCGTCTTTTTTGGTATAGTTTG
JMFS015G08+ TAG
JMFS008D09+ TAGAATATATATATATAATCGTCGTCTTTTTTGGTATAGTTTG
JMSF047C13+ TAGAATATATATATATAATCGTCGTCTTTTTTGGTATAGTTTGGTCGATCACGGTTGT
JMSF052C15+ TAGAATATATATATATAATCGTCGTCTTTTTTGGTATAGTTTGGTCGATCACGGTTGTGC
                      ____________________________________________________________
consensus TAGAATATATATATATAATCGTCGTCTTTTTTGGTATAGTTTGGTCGATCACGGTTGTGC