Previous Contig 008084:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012F17Sequence546008084 (10)gb:AY080701_15684244e-34Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165665008084 (10)gb:AY080701_15684242e-31Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165
JMFF048A04Sequence453008084 (10)gb:AY080701_15684247e-31Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165197008084 (10)
JMSF037D19Sequence693008084 (10)gb:AY080701_15684248e-37Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165666008084 (10)gb:AY080701_15684248e-37Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165
JMSF037M14Sequence692008084 (10)gb:AY080701_15684248e-37Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165
JMSF051P04Sequence676008084 (10)gb:AY080701_15684248e-37Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165
JMSF052J01Sequence687008084 (10)gb:AY080701_15684248e-37Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165664008084 (10)gb:AY080701_15684248e-37Arabidopsis thaliana unknown protein (At1g18730) mRNA, complete cds.>gb:AY117165

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048A04- GTATTGCATTTGCATTTCAGTATATGTTTGTGGAAATATAGGTAAATGAGAGGA
rJMFF012F17- ATGTTTGTGGAAATATAGGTAAATGAGAGGA
JMSF037M14+ AATATAGGTAAATGAGAGGA
JMSF052J01+ AATATAGGTAAATGAGAGGA
rJMSF052J01- TAAATGAGAGGA
rJMSF037D19- TAAATGAGAGGA
JMSF037D19+ AATATAGGTAAATGAGAGGA
JMSF051P04+ ATAGGTAAATGAGAGGA
                      ____________________________________________________________
consensus GTATTGCATTTGCATTTCAGTATATGTTTGTGGAAATATAGGTAAATGAGAGGA
 
. : . : . : . : . : . :
rJMFF048A04- CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
rJMFF012F17- CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
JMSF037M14+ CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
JMSF052J01+ CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
rJMSF052J01- CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
rJMSF037D19- CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
JMSF037D19+ CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
JMSF051P04+ CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
                      ____________________________________________________________
consensus CAGAAGATTGTAGCATCATCATATACATGTTTCTGGAAATTAAAATTACAATATAATGTC
 
. : . : . : . : . : . :
rJMFF048A04- AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
rJMFF012F17- AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
JMSF037M14+ AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
JMSF052J01+ AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
rJMSF052J01- AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
JMFF012F17+ CTAGCTCTCGTAGCCCTT
rJMSF037D19- AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
JMSF037D19+ AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
JMSF051P04+ AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
                      ____________________________________________________________
consensus AAACAAATGATCATTTGACAAGCTCTTCTTCCTTAGCCTCTTCTAGCTCTCGTAGCCCTT
 
. : . : . : . : . : . :
rJMFF048A04- CAACCTTCTGCTCTATCTCCTCT
rJMFF012F17- CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
JMSF037M14+ CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
JMSF052J01+ CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
rJMSF052J01- CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
JMFF012F17+ CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
rJMSF037D19- CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
JMSF037D19+ CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
JMSF051P04+ CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
                      ____________________________________________________________
consensus CAACCTTCTGCTCTATCTCCTCTATCAGCTCCTCACGCCATAGCTCCGCCCGAGATCTTT
 
. : . : . : . : . : . :
rJMFF012F17- CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
JMSF037M14+ CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
JMSF052J01+ CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
rJMSF052J01- CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
JMFF012F17+ CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
JMFF048A04+ ATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
rJMSF037D19- CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
JMSF037D19+ CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
JMSF051P04+ CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
                      ____________________________________________________________
consensus CTTCAATGTCTTCTTGCTTATCATAGATCCAATGTCCAGTACCATCCCCACCATCTCCTC
 
. : . : . : . : . : . :
rJMFF012F17- TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
JMSF037M14+ TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
JMSF052J01+ TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
rJMSF052J01- TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
JMFF012F17+ TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
JMFF048A04+ TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
rJMSF037D19- TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
JMSF037D19+ TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
JMSF051P04+ TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
                      ____________________________________________________________
consensus TATACTGCTCTGAATCATAGTAGGGATCTTTAGTAGAACCAAAGAAGCAGCATCCCCAAA
 
. : . : . : . : . : . :
rJMFF012F17- TAGTGAA-ATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
JMSF037M14+ TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
JMSF052J01+ TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
rJMSF052J01- TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
JMFF012F17+ TAGTGAA-ATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
JMFF048A04+ TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
rJMSF037D19- TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
JMSF037D19+ TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
JMSF051P04+ TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
                      ____________________________________________________________
consensus TAGTGAACATGATGTAAAATGAGTAAACATTTTTTATGGCTGCATCACTTAGATGCCAAA
 
. : . : . : . : . : . :
rJMFF012F17- CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
JMSF037M14+ CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
JMSF052J01+ CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
rJMSF052J01- CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
JMFF012F17+ CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
JMFF048A04+ CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
rJMSF037D19- CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
JMSF037D19+ CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
JMSF051P04+ CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
                      ____________________________________________________________
consensus CAGACTTGTGAGTGACGAGGTCCCTTTGGCCATCCAAGTGTTCAACCATTACTGCCATCA
 
. : . : . : . : . : . :
rJMFF012F17- ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
JMSF037M14+ ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
JMSF052J01+ ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
rJMSF052J01- ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
JMFF012F17+ ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
JMFF048A04+ ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAACTCCCTTCTGCTCTTCCCCCCC
rJMSF037D19- ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
JMSF037D19+ ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
JMSF051P04+ ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
                      ____________________________________________________________
consensus ATTGCAAACCTGGGAATGCATTCACTCTTGTTCTACAAC-CCCTTCTGCTCTTCCCCCCA
 
. : . : . : . : . : . :
rJMFF012F17- CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
JMSF037M14+ CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
JMSF052J01+ CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
rJMSF052J01- CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
JMFF012F17+ CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
JMFF048A04+ CCTTCTATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
rJMSF037D19- CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
JMSF037D19+ CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
JMSF051P04+ CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
                      ____________________________________________________________
consensus CCTTCAATCTGGTAACTACTGCAAGGGCTAAAGGCAGAATTTAAGCATTGCCCGAGTGGT
 
. : . : . : . : . : . :
rJMFF012F17- TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
JMSF037M14+ TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
JMSF052J01+ TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
rJMSF052J01- TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
JMFF012F17+ TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
JMFF048A04+ TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
rJMSF037D19- TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
JMSF037D19+ TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
JMSF051P04+ TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
                      ____________________________________________________________
consensus TTAGGAAGTTTTGATGGACAATGAAGAGAGGGGTTATGAATTCTTGGTTTGATAATCGTG
 
. : . : . : . : . : . :
rJMFF012F17- AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGT
JMSF037M14+ AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTC
JMSF052J01+ AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGT
rJMSF052J01- AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGT
JMFF012F17+ AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCT
JMFF048A04+ AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGT
rJMSF037D19- AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGT
JMSF037D19+ AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGT
JMSF051P04+ AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGTAGAAAGTC
                      ____________________________________________________________
consensus AAGCTCATCACAGCTTCAGCCATTTTTCCGTGCTGTGAAAGGATTGGTCTGTAGAAAGTC