Previous Contig 008081:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS044F11Sequence621008081 (3)sp|O82256|COLA_ARATH2e-34Zinc finger protein constans-like 10.>pir|G84920|G84920 hypothetical protein At2
JMSF001G12Sequence247008081 (3)729013971 (2)sp|O82256|COLA_ARATH4e-07Zinc finger protein constans-like 10.>pir|G84920|G84920 hypothetical protein At2
JMSF051O06Sequence675008081 (3)sp|O82256|COLA_ARATH3e-30Zinc finger protein constans-like 10.>pir|G84920|G84920 hypothetical protein At2665013971 (2)sp|O82256|COLA_ARATH2e-06Zinc finger protein constans-like 10.>pir|G84920|G84920 hypothetical protein At2

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS044F11+ CGTCGCCGGCGCCGCCGTAACGATCGTCGTCTTGAAGAAGG
                      ____________________________________________________________
consensus CGTCGCCGGCGCCGCCGTAACGATCGTCGTCTTGAAGAAGG
 
. : . : . : . : . : . :
JMFS044F11+ GCCTTTTTCCCGACATCCTGGAACCCGAAAACCGCCAGCAGTTCCGCGACGGAAGGGCAG
JMSF051O06+ GCGACGGNAGGGCAG
                      ____________________________________________________________
consensus GCCTTTTTCCCGACATCCTGGAACCCGAAAACCGCCAGCAGTTCCGCGACGGAAGGGCAG
 
. : . : . : . : . : . :
JMFS044F11+ CCGCTGAAGCCCTCGAGCGGGCGGCGGACGTGCGGCGCCGGCGAGAGGCAGAGAGTGTGG
JMSF051O06+ CCGCTGAAGCCCTCGAGCGGGCGGCGGACGTGCGGCGCCGGCGAGAGGCAGAGAGTGTGG
                      ____________________________________________________________
consensus CCGCTGAAGCCCTCGAGCGGGCGGCGGACGTGCGGCGCCGGCGAGAGGCAGAGAGTGTGG
 
. : . : . : . : . : . :
JMFS044F11+ GACTCCCAGTCGCAGTTCTGGCAGAAGACGGCGGCGTGGTTGCAGCAGAAGATGGTGGCC
JMSF051O06+ GACTCCCAGTCGCAGTTCTGGCAGAAGACGGCGGCGTGGTTGCAGCAGAAGATGGTGGCC
                      ____________________________________________________________
consensus GACTCCCAGTCGCAGTTCTGGCAGAAGACGGCGGCGTGGTTGCAGCAGAAGATGGTGGCC
 
. : . : . : . : . : . :
JMFS044F11+ GGAGAGGCATCGCAGGCGTCGCAGAGCAGGGAGCGCGTGTGCTTGGTGAAGAGAGGGTTC
JMSF051O06+ GGAGAGGCATCGCAGGCGTCGCAGAGCAGGGAGCGCGTGTGCTTGGTGAAGAGAGGGTTC
                      ____________________________________________________________
consensus GGAGAGGCATCGCAGGCGTCGCAGAGCAGGGAGCGCGTGTGCTTGGTGAAGAGAGGGTTC
 
. : . : . : . : . : . :
JMFS044F11+ GTGGAGTGCACCTCCCGGTCGCAGCCGAGGCAGAGACTCGCCGAATCGGCTCTGCAGTAC
JMSF051O06+ GTGGAGTGCACCTCCCGGTCGCAGCCGAGGCAGAGACTCGCCGAATCGGCTCTGCAGTAC
                      ____________________________________________________________
consensus GTGGAGTGCACCTCCCGGTCGCAGCCGAGGCAGAGACTCGCCGAATCGGCTCTGCAGTAC
 
. : . : . : . : . : . :
JMFS044F11+ AGCACCGCCGTGGCCGACCCGCAGAAATCGCAGTTCCGATTACTCTTCCCCTCCTCCGCC
JMSF051O06+ AGCACCGCCGTGGCCGACCCGCAGAAATCGCAGTTCCGATTACTCTTCCCCTCCTCCGCC
                      ____________________________________________________________
consensus AGCACCGCCGTGGCCGACCCGCAGAAATCGCAGTTCCGATTACTCTTCCCCTCCTCCGCC
 
. : . : . : . : . : . :
JMFS044F11+ GCCTCTTGCTCCTCTTTCAGCTCCGTCATCTCTGCAATTCAAGACTGCAACTTTCCCCCC
JMSF001G12+ TCAGCTCCGTCATCTCTGCAATTCAAGACTGCAACTTTCCCCCC
JMSF051O06+ GCCTCTTGCTCCTCTTTCAGCTCCGTCATCTCTGCAATTCAAGACTGCAACTTTCCCCCC
                      ____________________________________________________________
consensus GCCTCTTGCTCCTCTTTCAGCTCCGTCATCTCTGCAATTCAAGACTGCAACTTTCCCCCC
 
. : . : . : . : . : . :
JMFS044F11+ CTCCTTTCAGCCCTTTCTCAAAACAACAAAAACCCCTCTTTTTCTTTCTTGAAAAGGAAT
JMSF001G12+ CTCCTTTCAGCCCTTTCTCAAAACAACAAAAACCCCTCTTTTTCTTTCTTGAAAAGGAAT
JMSF051O06+ CTCCTTTCAGCCCTTTCTCAAAACAACAAAAACCCCTCTTTTTCTTTCTTGAAAAGGAAT
                      ____________________________________________________________
consensus CTCCTTTCAGCCCTTTCTCAAAACAACAAAAACCCCTCTTTTTCTTTCTTGAAAAGGAAT
 
. : . : . : . : . : . :
JMFS044F11+ CAAAAACAGAAATGGGAAATGGTTTAGGTAACCACTGGTCTACTCACTGTGACTGAGAAG
JMSF001G12+ CAAAAACAGAAATGGGAAATGGTTTAGGTAACCACTGGTCTACTCACTGTGACTGAGAAG
JMSF051O06+ CAAAAACAGAAATGGGAAATGGTTTAGGTAACCACTGGTCTACTCACTGTGACTGAGAAG
                      ____________________________________________________________
consensus CAAAAACAGAAATGGGAAATGGTTTAGGTAACCACTGGTCTACTCACTGTGACTGAGAAG
 
. : . : . : . : . : . :
JMFS044F11+ ATAGAGAGAGAAGGGATGGGAAATTGGGGAAATCTCTTGG
JMSF001G12+ ATAGAGAGAGAAGGGATGGGAAATTGGGGAAATCTCTTGGGAGAATCGCAGATTTGAGAT
JMSF051O06+ ATAGAGAGAGAAGGGATGGGAAATTGGGGAAATCTCTTGGGAGAATCGCAGATTTGAGAT
                      ____________________________________________________________
consensus ATAGAGAGAGAAGGGATGGGAAATTGGGGAAATCTCTTGGGAGAATCGCAGATTTGAGAT
 
. : . : . : . : . : . :
JMSF001G12+ GACAGACAAGCTGACATCGATT
JMSF051O06+ GACAGACAAGCTGACATCGATTAAGGATCTTTTTCGTTTTTTGTTGCAAATTTACTGCGC
                      ____________________________________________________________
consensus GACAGACAAGCTGACATCGATTAAGGATCTTTTTCGTTTTTTGTTGCAAATTTACTGCGC
 
. : . : . : . : . : . :
JMSF051O06+ CACCAACTTCTAGCTAGAATAGTAGTACGCACTACCTTATCCACCTTTTCGGCAAAGATC
                      ____________________________________________________________
consensus CACCAACTTCTAGCTAGAATAGTAGTACGCACTACCTTATCCACCTTTTCGGCAAAGATC