Previous Contig 008080:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033G14Sequence574008080 (7)750009765 (4)gb:AY048287_15617482e-59Arabidopsis thaliana AT3g54020/F5K20_320 mRNA, complete cds.
JMSF006D04Sequence325008080 (7)135008080 (7)
JMSF007D04Sequence351008080 (7)726008080 (7)pir|A84799|A847998e-07hypothetical protein At2g37940 [imported] - Arabidopsis thaliana>gb:AC007661_153
JMSF010P07Sequence211008080 (7)685009765 (4)gb:AY048287_15617482e-51Arabidopsis thaliana AT3g54020/F5K20_320 mRNA, complete cds.
JMSF051O01Sequence694008080 (7)758009765 (4)gb:AY048287_15617482e-65Arabidopsis thaliana AT3g54020/F5K20_320 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007D04- AATTTCACCATAGTACTAAGCAGTGAAGCACTGCA
                      ____________________________________________________________
consensus AATTTCACCATAGTACTAAGCAGTGAAGCACTGCA
 
. : . : . : . : . : . :
rJMSF007D04- GCCTAGATGTGGTCCCATAAACACCTATACAGAACTTAATCACAGGCTTTAATCTTCAAG
                      ____________________________________________________________
consensus GCCTAGATGTGGTCCCATAAACACCTATACAGAACTTAATCACAGGCTTTAATCTTCAAG
 
. : . : . : . : . : . :
rJMSF007D04- AAAACCAAGACCACACTTAACAGAATAAAAATTTGCATTTCCACTGAATCACAACCTGAC
                      ____________________________________________________________
consensus AAAACCAAGACCACACTTAACAGAATAAAAATTTGCATTTCCACTGAATCACAACCTGAC
 
. : . : . : . : . : . :
rJMSF007D04- AAATTAGACCTCCAAGAAGATACTTCCAATTCTCGGCAAGAAGCTTGATCTCAGCTGTAG
                      ____________________________________________________________
consensus AAATTAGACCTCCAAGAAGATACTTCCAATTCTCGGCAAGAAGCTTGATCTCAGCTGTAG
 
. : . : . : . : . : . :
rJMSF006D04- GCACAAATTCTCTTCCATAGCCTCTCCACAGAACAGAAATAACAAGTGAATCAAG
rJMSF007D04- TCTCTGCACAAATTCTCTTCCATAGCCTCTCCACAGAACAGAAATAACAAGTGAATCAAG
                      ____________________________________________________________
consensus TCTCTGCACAAATTCTCTTCCATAGCCTCTCCACAGAACAGAAATAACAAGTGAATCAAG
 
. : . : . : . : . : . :
rJMSF006D04- AAAATGCCTTATTTTTGTTAAACGAGAGAATAAAATATGGAATTTAAATCAAAGAAGTAT
rJMSF007D04- AAAATGCCTTATTTTTGTTAAACGAGAGAATAAAATATGGAATTTAAATCAAAGAAGTAT
                      ____________________________________________________________
consensus AAAATGCCTTATTTTTGTTAAACGAGAGAATAAAATATGGAATTTAAATCAAAGAAGTAT
 
. : . : . : . : . : . :
rJMSF006D04- CTTGAAGCANTATAGCAGAG
rJMSF007D04- CTTGAAGCAATATAGCAGAGAAAAAAGACGAACCTTTGAAGCCTCGCGACCAATGTAAAG
JMSF051O01+ CTTTGAAGCCTCGCGACCAATGTAAAG
                      ____________________________________________________________
consensus CTTGAAGCAATATAGCAGAGAAAAAAGACGAACCTTTGAAGCCTCGCGACCAATGTAAAG
 
. : . : . : . : . : . :
rJMSF007D04- CGACATCTTCTTCGTCTGTGTGCACCACTACCACCACTTCCATATTACATCAGAAACCTA
JMSF051O01+ CGACATCTTCTTCGTCTGTGTGCACCACTACCACCACTTCCATATTACATCAGAAACCTA
                      ____________________________________________________________
consensus CGACATCTTCTTCGTCTGTGTGCACCACTACCACCACTTCCATATTACATCAGAAACCTA
 
. : . : . : . : . : . :
rJMSF007D04- CTGCGAAGGTCAACATCGCTCATCCCGAGCCCCCCTTTCTTCCTCGGAAAACAACGCAAT
JMFF033G14+ GGTCAACATCGCTCATCCCGAGCCCCCCTTTCTTCCTCGGAAAACAACGCAAT
JMSF051O01+ CTGCGAAGGTCAACATCGCTCATCCCGAGCCCCCCTTTCTTCCTCGGAAAACAACGCAAT
                      ____________________________________________________________
consensus CTGCGAAGGTCAACATCGCTCATCCCGAGCCCCCCTTTCTTCCTCGGAAAACAACGCAAT
 
. : . : . : . : . : . :
rJMSF007D04- TCCAATTCCGACGACCCGAACTCGGCCACGATCGCCAAAAAGGAAAATCCCGGGAACCGG
JMSF007D04+ ACCGG
JMFF033G14+ TCCAATTCCGACGACCCGAACTCGGCCACGATCGCCAAAAAGGAAAATCCCGGGAACCGG
JMSF051O01+ TCCAATTCCGACGACCCGAACTCGGCCACGATCGCCAAAAAGGAAAATCCCGGGAACCGG
                      ____________________________________________________________
consensus TCCAATTCCGACGACCCGAACTCGGCCACGATCGCCAAAAAGGAAAATCCCGGGAACCGG
 
. : . : . : . : . : . :
rJMSF007D04- CGGCAAACGACAAGGAATCCGAGGATTCCCTCGACGTAAAAT-CAAACTACGGGATCTCA
JMSF007D04+ CGGCAAACGACAAGGAATCCGAGGATTCCCTCGACGTAAAAT-CAAACTACGGGATCTCA
JMFF033G14+ CGGCAAACGACAAGGAATCCGAGGATTCCCTCGACGTAAAAT-CAAACTACGGGATCTCA
JMSF006D04+ GGATTCCCTCGACGTAAAATCCAAACTACGGGATCTCA
JMSF051O01+ CGGCAAACGACAAGGAATCCGAGGATTCCCTCGACGTAAAAT-CAAACTACGGGATCTCA
                      ____________________________________________________________
consensus CGGCAAACGACAAGGAATCCGAGGATTCCCTCGACGTAAAAT-CAAACTACGGGATCTCA
 
. : . : . : . : . : . :
rJMSF007D04- ATTCGAGAAACGACCAAATTAAATGACAACCCAAATCCCACAATCGCAGAACAAAGTCTG
JMSF007D04+ ATTCGAGAAACGACCAAATTAAATGACAACCCAAATCCCACAATCGCAGAACAAAGTCTG
JMFF033G14+ ATTCGAGAAACGACCAAATTAAATGACAACCCAAATCCCACAATCGCAGAACAAAGTCTG
JMSF006D04+ ATTCGAGAAACGACCAAATTAAATGACAACCCAAATCCCACAATCGCAGAACAAAGTCTG
JMSF051O01+ ATTCGAGAAACGACCAAATTAAATGACAACCCAAATCCCACAATCGCAGAACAAAGTCTG
                      ____________________________________________________________
consensus ATTCGAGAAACGACCAAATTAAATGACAACCCAAATCCCACAATCGCAGAACAAAGTCTG
 
. : . : . : . : . : . :
rJMSF007D04- AGGAAAATCAATTCCACAATGGCAATTCAAAG
JMSF007D04+ AGGAAAATCAATTCCACAATGGCAATTCAAAGACATAAAGAAATTGACCGATCGATTCCT
JMSF010P07+ GCAATTCAAAGACATAAAGAAATTGACCGATCGATTCCT
JMFF033G14+ AGGAAAATCAATTCCACAATGGCAATTCAAAGACATAAAGAAATTGACCGATCGATTCCT
JMSF006D04+ AGGAAAATCAATTCCACAATGGCAATTCAAAGACATAAAGAAATTGACCGATCGATTCCT
JMSF051O01+ AGGAAAATCAATTCCACAATGGCAATTCAAAGACATAAAGAAATTGACCGATCGATTCCT
                      ____________________________________________________________
consensus AGGAAAATCAATTCCACAATGGCAATTCAAAGACATAAAGAAATTGACCGATCGATTCCT
 
. : . : . : . : . : . :
JMSF007D04+ CTATCTACATACTGTGTTTACGCGTGTATTTTTTTTA--TTTTTTATTTTTCTCTTCAGT
JMSF010P07+ CTATCTACATACTGTGTTTACGCGTGTATTTTTTTTATTTTTTTTATTTTTCTCTTCAGT
JMFF033G14+ CTATCTACATACTGTGTTTACGCGTGTATTTTTTTTA-TTTTTTTATTTTTCTCTTCAGT
JMSF006D04+ CTATCTACATACTGTGTTTACGCGTGTATTTTTTTTA--TTTTTTATTTTTCTCTTCAGT
JMSF051O01+ CTATCTACATACTGTGTTTACGCGTGTATTTTTTTTA-TTTTTTTATTTTTCTCTTCAGT
                      ____________________________________________________________
consensus CTATCTACATACTGTGTTTACGCGTGTATTTTTTTTA-TTTTTTTATTTTTCTCTTCAGT
 
. : . : . : . : . : . :
JMSF007D04+ TCTCTCTCTATATAAATGTATATTTTATCTGCGTCTCGGGGTGATTCGTCTCCTTAGATG
JMSF010P07+ TCTCTCTCTATATAAATGTATATTTTATCTGCGTCTCGGGGTGATTCGTCTCCTTAGATG
JMFF033G14+ TCTCTCTCTATATAAATGTATATTTTATCTGCGTCTCGGGGTGATTCGTCTCCTTAGATG
JMSF006D04+ TCTCTCTCTATATAAATGTATATTTTATCTGCGTCTCGGGGTGATTCGTCTCCTTAGATG
JMSF051O01+ TCTCTCTCTATATAAATGTATATTTTATCTGCGTCTCGGGGTGATTCGTCTCCTTAGATG
                      ____________________________________________________________
consensus TCTCTCTCTATATAAATGTATATTTTATCTGCGTCTCGGGGTGATTCGTCTCCTTAGATG
 
. : . : . : . : . : . :
JMSF007D04+ CTAAGACTGCTAAAAACGCGAGTCGAACACGGAGCGGCAGTTGAGT
JMSF010P07+ CTAAGACTGCTAAAAACGCGAGTCGAACACGGAGCGGCAGTTGAGT
JMFF033G14+ CTAAGACTGCTAAAAACGCGAGTCGAACACGGAGCGGCAGTTGAGTTCCAGAGAGAGAGA
JMSF006D04+ CTAAGACTGCTAAAAACGCGAGTCGAACACGGAGCGGCAGTTGAGT
JMSF051O01+ CTAAGACTGCTAAAAACGCGAGTCGAACACGGAGCGGCAGTTGAGTTCCAGAGAGAGAGA
                      ____________________________________________________________
consensus CTAAGACTGCTAAAAACGCGAGTCGAACACGGAGCGGCAGTTGAGTTCCAGAGAGAGAGA
 
. : . : . : . : . : . :
JMFF033G14+ GGGGAGGGAGAAACAAGAGAGCCTTTTTAAAACACTGGGAAAAGGAAAATCGCCGGTACG
JMSF051O01+ GGGGAGGGAGAAACAAGAGAGCCTTTTTAAAACACTGGGAAAAGGAAAATCGCCGGTACG
                      ____________________________________________________________
consensus GGGGAGGGAGAAACAAGAGAGCCTTTTTAAAACACTGGGAAAAGGAAAATCGCCGGTACG
 
. : . : . : . : . : . :
JMFF033G14+ AGAAAAACTGTCTCCCTTTGCGAAAATTTGCTGGAAATTCGAG
JMSF051O01+ AGAAAAACTGTCTCCCTTTGCGAAAATTTGCTGGAAATTCGAGACTGAAAATGAACCCCC
                      ____________________________________________________________
consensus AGAAAAACTGTCTCCCTTTGCGAAAATTTGCTGGAAATTCGAGACTGAAAATGAACCCCC