Previous Contig 008075:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N09Sequence252008075 (6)gb:AB007644_15101375e-18Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16615008075 (6)gb:AB007644_15101372e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16
JMSF007C04Sequence359004858 (3)gb:AP004346_18405843e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P065589008075 (6)gb:AB007644_15101371e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16
JMSF026J10Sequence659008075 (6)gb:AB007644_15101372e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16628008075 (6)gb:AB007644_15101372e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16
JMSF051M14Sequence684008075 (6)gb:AB007644_15101374e-22Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17.>gb:BT015927_16

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026J10+ GAGTTCCCAAATTCTTGCATATGG
rJMSF001N09+ GCATATGG
rJMSF007C04+ TCTTGCATATGG
JMSF001N09- GCATATGG
JMSF026J10- GAGTTCCCAAATTCTTGCATATGG
JMSF051M14- GAGTTCCCAAATTCTTGCATATGG
                      ____________________________________________________________
consensus GAGTTCCCAAATTCTTGCATATGG
 
. : . : . : . : . : . :
rJMSF026J10+ ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
rJMSF001N09+ ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
rJMSF007C04+ ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
JMSF001N09- ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
JMSF026J10- ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
JMSF051M14- ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
                      ____________________________________________________________
consensus ATAACTTCCAATCCCAAACCCGGAAAGGCTTATTCAAATGCCAGAAGAAGAGGCTAACCC
 
. : . : . : . : . : . :
rJMSF026J10+ AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
rJMSF001N09+ AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
rJMSF007C04+ AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
JMSF001N09- AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
JMSF026J10- AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
JMSF051M14- AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
                      ____________________________________________________________
consensus AGGATCAAGTGAGGCTGTTAGAGGGGAGCTTTAACGTGAATAACAAGCTGGACGCGGATA
 
. : . : . : . : . : . :
rJMSF026J10+ GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
rJMSF001N09+ GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
rJMSF007C04+ GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
JMSF001N09- GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
JMSF026J10- GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
JMSF051M14- GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
                      ____________________________________________________________
consensus GCAAGTCCCAGCTGGCGCAGCAGCTGGGATTGCCACCGAGGCAGATTGCAATTTGGTATC
 
. : . : . : . : . : . :
rJMSF026J10+ AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
rJMSF001N09+ AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
rJMSF007C04+ AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
JMSF001N09- AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
JMSF026J10- AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
JMSF051M14- AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
                      ____________________________________________________________
consensus AGAACAAGCGAGCGCGGCGCAAGAGCCAGAGCCTGGAGGTGGACCACAAGGCCATGCATG
 
. : . : . : . : . : . :
rJMSF026J10+ AGAGGCTGGAGGAGGTTTTGTCGGATAACGAGCGGCTGAGAGAAGAGGTGCAGAAGGCGC
rJMSF001N09+ AGAGGCTGGAGGAGGTTTTGTCGGATAACGAGCGGCTGAGAGAAGAGGTGCAGAAGGCGC
rJMSF007C04+ AGAGGCTGGAGGAGGTTTTGTCGGATAACGAGCGGCTGAGAGAAGAGGTGCAGAAGGCGC
JMSF001N09- AG
JMSF026J10- AGAGGCTGGAGGAGGTTTTGTCGGATAACGAGCGGCTGAGAGAAGAGGTGCAGAAGGCGC
JMSF051M14- AGAGGCTGGAGGAGGTTTTGTCGGATAACGAGCGGCTGAGAGAAGAGGTGCAGAAGGCGC
                      ____________________________________________________________
consensus AGAGGCTGGAGGAGGTTTTGTCGGATAACGAGCGGCTGAGAGAAGAGGTGCAGAAGGCGC
 
. : . : . : . : . : . :
rJMSF026J10+ AGGAGATGCTGCAGGTGGCGGCGGCGGTGGCGCCCTACTCCTGCAGCTCCGGTGATGAAG
rJMSF001N09+ AGGAGATGCTGCAGGTGGCGGCGGCGGTGGCGCCCTACTCCTGCAGCTCCGGTGATGAAG
rJMSF007C04+ AGGAGATGCTGCAGGTGGCGGCGGCGGTGGCGCCCTACTCCTGCAGCTCCGGTGATGAAG
JMSF026J10- AGGAGATGCTGCAGGTGGCGGCGGCGGTGGCGCCCTACTCCTGCAGCTCCGGTGATGAAG
JMSF051M14- AGGAGATGCTGCAGGTGGCGGCGGCGGTGGCGCCCTACTCCTGCAGCTCCGGTGATGAAG
                      ____________________________________________________________
consensus AGGAGATGCTGCAGGTGGCGGCGGCGGTGGCGCCCTACTCCTGCAGCTCCGGTGATGAAG
 
. : . : . : . : . : . :
rJMSF026J10+ CCGGTGGGAGCTTGGGTTTGCTTCATGGTTCGTCCAAAGAGCTGTATGCTTGCTTGCTGG
rJMSF001N09+ CCGGTGGGAGCTTGGGTTTGCTTCATGGTTCGTCCAAAGAGCTGTATGCTTGCTTGCTGG
rJMSF007C04+ CCGGTGGGAGCTTGGGTTTGCTTCATGGTTCGTCCAAAGAGCTGTATGCTTGCTTGCTGG
JMSF026J10- CCGGTGGGAGCTTGGGTTTGCTTCATGGTTCGTCCAAAGAGCTGTATGCTTGCTTGCTGG
JMSF051M14- CCGGTGGGAGCTTGGGTTTGCTTCATGGTTCGTCCAAAGAGCTGTATCCTTGCTTGCTGG
                      ____________________________________________________________
consensus CCGGTGGGAGCTTGGGTTTGCTTCATGGTTCGTCCAAAGAGCTGTATGCTTGCTTGCTGG
 
. : . : . : . : . : . :
rJMSF026J10+ ATGAGCACGAGAGCCAGTTTGGAACCTCGCCGGCTGATTTATTGCACAACTTCTTTGCTC
rJMSF001N09+ ATGAGCACGAGAGCCAGTTTGGAACCTCGCCGGCTGATTTATTGCACAACTTCTTTGCTC
rJMSF007C04+ ATGAGCACGAGAGCCAGTTTGGAACCTCGCCGGCTGATTTATTGCACAACTTCTTTGCTC
JMSF026J10- ATGAGCACGAGAGCCAGTTTGGAACCTCGCCGGCTGATTTATTGCACAACTTCTTTGCTC
JMSF051M14- ATGAGCACGAGAGCCAGTTTGGAACCTCGCCGGCTGATTTATTGCACAACTTCTTTGCTC
                      ____________________________________________________________
consensus ATGAGCACGAGAGCCAGTTTGGAACCTCGCCGGCTGATTTATTGCACAACTTCTTTGCTC
 
. : . : . : . : . : . :
rJMSF026J10+ CACCTGGATTATCTTAATTAATACTAGTTTAATTTAATTTAATTTGGTGGTTGGTTAGAA
rJMSF001N09+ CACCTGGATTATCTTAATTAATACTAGTTTAATTTAATTTAATTTGGTGGTTGGTTAGAA
rJMSF007C04+ CACCTGGATTATCTTAATTAATACTAGTTTAATTTAATTTAATTTGGTGGTTGGTTAGAA
JMSF026J10- CACCTGGATTATCTTAATTAATACTAGTTTAATTTAATTTAATTTGGTGGTTGGTTAGAA
JMSF051M14- CACCTGGATTATCTTAATTAATACTAGTTTAATTTAATTTAATTTGGTGGTTGGTTAGAA
                      ____________________________________________________________
consensus CACCTGGATTATCTTAATTAATACTAGTTTAATTTAATTTAATTTGGTGGTTGGTTAGAA
 
. : . : . : . : . : . :
rJMSF026J10+ TTTTACCATCTGTCGTACGTTAATTACTGTCTGGCTTGGCTTTTGCAGCTGGACAATCAA
rJMSF001N09+ TTTTACCATCTGTCGTACGTTAATTACTGTCTGGCTTGGCTTTTGCAGCTGGACAATCAA
rJMSF007C04+ TTTTACCATCTGTCGTACGTTAATTACTGTCTGGCTT
JMSF026J10- TTTTACCATCTGTCGTACGTTAATTACTGTCTGGCTTGGCTTTTGCAGCTGGACAATCAA
JMSF051M14- TTTTACCATCTGTCGTACGTTAATTACTGTCTGGCTTGGCTTTTGCAGCTGGACAATCAA
                      ____________________________________________________________
consensus TTTTACCATCTGTCGTACGTTAATTACTGTCTGGCTTGGCTTTTGCAGCTGGACAATCAA
 
. : . : . : . : . : . :
rJMSF026J10+ GTCT
rJMSF001N09+ GTCT
JMSF026J10- GTCTGTGTAAAGTAAATAATTGTCACATAATGGAA
JMSF051M14- GTCTGTGTAAAGTAAATAATTGTCACATAATGGAAATTTACCTTTACTCCAAAAAAAAAA
                      ____________________________________________________________
consensus GTCTGTGTAAAGTAAATAATTGTCACATAATGGAAATTTACCTTTACTCCAAAAAAAAAA