Previous Contig 008071:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035N17Sequence556008071 (3)715009879 (4)
JMSF013F10Sequence240008071 (3)774009879 (4)gb:BNA010093_16332602e-57Brassica napus mRNA for MAP3K beta 1 protein kinase.
JMSF051L01Sequence655008071 (3)717009879 (4)gb:BNA010093_16332602e-49Brassica napus mRNA for MAP3K beta 1 protein kinase.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035N17+ TCTCAGACTATCTTTAACAGGGGGAGGGGTATCCG
JMSF051L01+ TTCAGAATCATCAGCCTCAATTCTCAGACTATCTTTAACAGGGGGAGGGGTATCCG
                      ____________________________________________________________
consensus TTCAGAATCATCAGCCTCAATTCTCAGACTATCTTTAACAGGGGGAGGGGTATCCG
 
. : . : . : . : . : . :
JMFF035N17+ AAGACGAGCTCGAATTCGAGGCCTCCAATTTAGCGACGGGAATCTCGAAGTCCTCCATAG
JMSF051L01+ AAGACGAGCTCGAATTCGAGGCCTCCAATTTAGCGACGGGAATCTCGAAGTCCTCCATAG
                      ____________________________________________________________
consensus AAGACGAGCTCGAATTCGAGGCCTCCAATTTAGCGACGGGAATCTCGAAGTCCTCCATAG
 
. : . : . : . : . : . :
JMFF035N17+ AAACCCCCAAACGGGCCAAACATCTGAAAACATCGTCAATTTCGCCACCGGAGCCGTCGA
JMSF051L01+ AAACCCCCAAACGGGCCAAACATCTGAAAACATCGTCAATTTCGCCACCGGAGCCGTCGA
                      ____________________________________________________________
consensus AAACCCCCAAACGGGCCAAACATCTGAAAACATCGTCAATTTCGCCACCGGAGCCGTCGA
 
. : . : . : . : . : . :
JMFF035N17+ TTCGGATACTCTTACTGCCGTCCAGTTCCAGCGATCGGCTCCACTTACTGTCCAGCTCCA
JMSF051L01+ TTCGGATACTCTTACTGCCGTCCAGTTCCAGCGATCGGCTCCACTTACTGTCCAGCTCCA
                      ____________________________________________________________
consensus TTCGGATACTCTTACTGCCGTCCAGTTCCAGCGATCGGCTCCACTTACTGTCCAGCTCCA
 
. : . : . : . : . : . :
JMFF035N17+ GCGACCGGCCAGTACGGGAAGTGGAGCCATCCCCGGAAAGAAGATGAGGTAGACGGCTCG
JMSF051L01+ GCGACCGGCCAGTACGGGAAGTGGAGCCATCCCCGG-AAGAAGATGAGGTAGACGGCTCG
                      ____________________________________________________________
consensus GCGACCGGCCAGTACGGGAAGTGGAGCCATCCCCGGAAAGAAGATGAGGTAGACGGCTCG
 
. : . : . : . : . : . :
JMFF035N17+ TAGTCGACATTCCTCAGAGCGATGCTGCGCTCGAGCTTCGGCGAAGGCTTGGCGGCAGCT
JMSF051L01+ TAGTCGACATTCCTCAGAGCGATGCTGCGCTCGAGCTTCGGCGAAGGCTTGGCGGCAGCT
                      ____________________________________________________________
consensus TAGTCGACATTCCTCAGAGCGATGCTGCGCTCGAGCTTCGGCGAAGGCTTGGCGGCAGCT
 
. : . : . : . : . : . :
JMFF035N17+ GATTTAGATCCGCGTCTTGACTTGGAGTCCATGCGCTTCTTAGGAACCAAGATCGAAGGT
JMSF013F10+ TAGGAACCAAGATCGAAGGT
JMSF051L01+ GATTTAGATCCGCGTCTTGACTTGGAGTCCATGCGCTTCTTAGGAACCAAGATCGAAGGT
                      ____________________________________________________________
consensus GATTTAGATCCGCGTCTTGACTTGGAGTCCATGCGCTTCTTAGGAACCAAGATCGAAGGT
 
. : . : . : . : . : . :
JMFF035N17+ AACCGATGCATCTCGATTCCAAGGTCGAGCTCGATCCATGTAGCGGTACGCCAATTGCTC
JMSF013F10+ AACCGATGCATCTCGATTCCAAGGTCGAGCTCGATCCATGTAGCGGTACGCCAATTGCTC
JMSF051L01+ AACCGATGCATCTCGATTCCAAGGTCGAGCTCGATCCATGTAGCGGTACGCCAATTGCTC
                      ____________________________________________________________
consensus AACCGATGCATCTCGATTCCAAGGTCGAGCTCGATCCATGTAGCGGTACGCCAATTGCTC
 
. : . : . : . : . : . :
JMFF035N17+ AAAGGCAGAATTGAAGTAGCAACAGTAATCCGTTGGAATTTCCTAATCTTTCGGAACGCA
JMSF013F10+ AAAGGCAGAATTGAAGTAGCAACAGTAATCCGTTGGAATTTCCTAATCTTTCGGAACGCA
JMSF051L01+ AAAGGCAGAATTGAAGTAGCAACAGTAATCCGTTGGAATTTCCTAATCTTTCGGAACGCA
                      ____________________________________________________________
consensus AAAGGCAGAATTGAAGTAGCAACAGTAATCCGTTGGAATTTCCTAATCTTTCGGAACGCA
 
. : . : . : . : . : . :
JMFF035N17+ CCGGCGCAATTTGGTAGAGCTCAGGAAATGGGGAAGAAAGT
JMSF013F10+ CCGGCGCAATTTGGTAGAGCTCAGGAAATGGGGAAGAAAGTGAAATGAAATCGCCGGCGG
JMSF051L01+ CCGGCGCAATTTGGTAGAGCTCAGGAAATGGGGAAGAAAGTGAAATGAAATCGCCGGCGG
                      ____________________________________________________________
consensus CCGGCGCAATTTGGTAGAGCTCAGGAAATGGGGAAGAAAGTGAAATGAAATCGCCGGCGG
 
. : . : . : . : . : . :
JMSF013F10+ CGGTGATGAGAGAGAAAGAGAGAGAGCAGAGTAGCAGAC
JMSF051L01+ CGGTGATGAGAGAGAAAGAGAGAGAGCAGAGTAGCAGACAAGAGACTGGTAAACGCCGTC
                      ____________________________________________________________
consensus CGGTGATGAGAGAGAAAGAGAGAGAGCAGAGTAGCAGACAAGAGACTGGTAAACGCCGTC