Previous Contig 008068:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS132B06Sequence601008068 (3)pir|S21495|S214953e-70tomato leucine zipper-containing protein - tomato>gb:LELEUZIP_1684358 L.esculent
JMSF007C12Sequence341008068 (3)pir|S21495|S214959e-24tomato leucine zipper-containing protein - tomato>gb:LELEUZIP_1684358 L.esculent
JMSF051K02Sequence605008068 (3)pir|S21495|S214952e-51tomato leucine zipper-containing protein - tomato>gb:LELEUZIP_1684358 L.esculent754024475pir|S21495|S214953e-75tomato leucine zipper-containing protein - tomato>gb:LELEUZIP_1684358 L.esculent

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS132B06+ CTCCAGCTCCGTCCACTGCATTTTCTGCACCTCGTC
                      ____________________________________________________________
consensus CTCCAGCTCCGTCCACTGCATTTTCTGCACCTCGTC
 
. : . : . : . : . : . :
JMFS132B06+ GATGCTCAGCTTCTGTATCCCCAGGCGCGCGAGGCTCTCCTCCAGGAACTCCCGCCGGCT
                      ____________________________________________________________
consensus GATGCTCAGCTTCTGTATCCCCAGGCGCGCGAGGCTCTCCTCCAGGAACTCCCGCCGGCT
 
. : . : . : . : . : . :
JMFS132B06+ GGTGCTGTACGCGTGGGAGCACTCCTTCCCGTAGCCGGCCGCCACCATCCGCTTCGCGAT
                      ____________________________________________________________
consensus GGTGCTGTACGCGTGGGAGCACTCCTTCCCGTAGCCGGCCGCCACCATCCGCTTCGCGAT
 
. : . : . : . : . : . :
JMFS132B06+ CTCGTGGAGATCGCTGATGGTCCCCGCCGGGAGAGCGTCGATGATGATATCGTAGTCGGT
                      ____________________________________________________________
consensus CTCGTGGAGATCGCTGATGGTCCCCGCCGGGAGAGCGTCGATGATGATATCGTAGTCGGT
 
. : . : . : . : . : . :
JMFS132B06+ GATGGGATGCGCCACCGGAATCTCGCCGCCGTCGTCGTCGTCCGCTTCCTCCGAGTCCGA
JMSF051K02+ TCCGA
                      ____________________________________________________________
consensus GATGGGATGCGCCACCGGAATCTCGCCGCCGTCGTCGTCGTCCGCTTCCTCCGAGTCCGA
 
. : . : . : . : . : . :
JMFS132B06+ CGAGAAATCCCGATTGGCCGACTCGCCGTTTCGGTAGTTGGTCAAATCGAAGGACTCCGA
JMSF051K02+ CGAGAAATCCCGATTGGCCGACTCGCCGTTTCGGTAGTTGGTCAAATCGAAGGACTCCGA
                      ____________________________________________________________
consensus CGAGAAATCCCGATTGGCCGACTCGCCGTTTCGGTAGTTGGTCAAATCGAAGGACTCCGA
 
. : . : . : . : . : . :
JMFS132B06+ CCCACGCTCCATTAGGGTTTTGAACTCGTCCTCCAGCCGGAACATCGCCTGCTGGAGCAA
JMSF051K02+ CCCACGCTCCATTAGGGTTTTGAACTCGTCCTCCAGCCGGAACATCGCCTGCTGGAGCAA
                      ____________________________________________________________
consensus CCCACGCTCCATTAGGGTTTTGAACTCGTCCTCCAGCCGGAACATCGCCTGCTGGAGCAA
 
. : . : . : . : . : . :
JMFS132B06+ ATCCTCGGCCCGGTCCAAACACGAAGCCACCGGCTTTTCATTCCCCATCGGAGTCCACTC
JMSF051K02+ ATCCTCGGCCCGGTCCAAACACGAAGCCACCGGCTTTTCATTCCCCATCGGAGTCCACTC
                      ____________________________________________________________
consensus ATCCTCGGCCCGGTCCAAACACGAAGCCACCGGCTTTTCATTCCCCATCGGAGTCCACTC
 
. : . : . : . : . : . :
JMFS132B06+ CCGAATCGCAGATATCAGTTCATCCACAGCTTCAAGAAACGCAGTAGAATCAGCAGAATC
JMSF007C12+ ATCAGCAGAATC
JMSF051K02+ CCGAATCGCAGATATCAGTTCATCCACAGCTTCAAGAAACGCAGTAGAATCAGCAGAATC
                      ____________________________________________________________
consensus CCGAATCGCAGATATCAGTTCATCCACAGCTTCAAGAAACGCAGTAGAATCAGCAGAATC
 
. : . : . : . : . : . :
JMFS132B06+ AGACCAGACCGGATGCTCCGCCGACACATACCGAGAGATCTGCCGGTCCAGGGACTTGAG
JMSF007C12+ AGACCAGACCGGATGNTCCGCCGACACATACCGAGAGATCTGCCGGTCCAGGGACTTGAG
JMSF051K02+ AGACCAGACCGGATGCTCCGCCGACACATACCGAGAGATCTGCCGGTCCAGGGACTTGAG
                      ____________________________________________________________
consensus AGACCAGACCGGATGCTCCGCCGACACATACCGAGAGATCTGCCGGTCCAGGGACTTGAG
 
. : . : . : . : . : . :
JMFS132B06+ GGTCCGTTCTAGCGCGGCGCACCCA
JMSF007C12+ GGTCCGTTCTAGCGCGGCGCACCCACGCGAATCCTCCTCGGAGAGCTTCTCGCTGAGCTT
JMSF051K02+ GGTCCGTTCTAGCGCGGCGCACCCACGCGAATCCTCCTCGGAGAGCTTCTCGCTGAGCTT
                      ____________________________________________________________
consensus GGTCCGTTCTAGCGCGGCGCACCCACGCGAATCCTCCTCGGAGAGCTTCTCGCTGAGCTT
 
. : . : . : . : . : . :
JMSF007C12+ CTCCCTCAATCGGCCATCGAAGTTGGAGAAAATCTGGAGAATATCATCGGTCATAGTATC
JMSF051K02+ CTCCCTCAATCGGCCATCGAAGTTGGAGAAAATCTGGAGAATATCATCGGTCATAGTATC
                      ____________________________________________________________
consensus CTCCCTCAATCGGCCATCGAAGTTGGAGAAAATCTGGAGAATATCATCGGTCATAGTATC
 
. : . : . : . : . : . :
JMSF007C12+ GGTGTGACCCAGAGTCTTGGCTATGTGCCGGGCCACGGCTATAAGCTTCTCCTCACCGTT
JMSF051K02+ GGTGTGACCCAGAGTCTTGGCTATGTGCCGGGCCACGGCTATAAGCTTCTCCTCACCGTT
                      ____________________________________________________________
consensus GGTGTGACCCAGAGTCTTGGCTATGTGCCGGGCCACGGCTATAAGCTTCTCCTCACCGTT
 
. : . : . : . : . : . :
JMSF007C12+ TTCCGCCATCGCCACGAAGAAAAGGGCAAATCTTTACAACTGGGTTCTTCAAAACTCAGG
JMSF051K02+ TTCCGCCATCGCCACGAAGAAAAGGGCAAATCTTTACAACTGGGTTCTTCAAAACTCAGG
                      ____________________________________________________________
consensus TTCCGCCATCGCCACGAAGAAAAGGGCAAATCTTTACAACTGGGTTCTTCAAAACTCAGG
 
. : . : . : . : . : . :
JMSF007C12+ CCTATGCATCGAAAATCATTGGATTTGT
JMSF051K02+ CCTATGCATCGAAAATCATTGGATTTGTGAAGGTATTTGGGGGGAGAGAGTTGAAGACTC
                      ____________________________________________________________
consensus CCTATGCATCGAAAATCATTGGATTTGTGAAGGTATTTGGGGGGAGAGAGTTGAAGACTC