Previous Contig 008065:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS098C06Sequence627008065 (2)gb:AK117129_18151762e-07Arabidopsis thaliana At1g55320 mRNA for putative acetyl-CoA synthetase, complete
JMSF051J09Sequence630008065 (2)gb:AK117129_18151762e-07Arabidopsis thaliana At1g55320 mRNA for putative acetyl-CoA synthetase, complete718007310 (3)gb:AC135563_17425856e-14Oryza sativa chromosome 3 BAC OSJNBb0015I02 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS098C06+ AGAACTTGTGAAATTGTTTAAAACTGNCAATTGGATCCTTGTAAGATG
JMSF051J09+ CAATTGGATCCTTGTAAGATG
                      ____________________________________________________________
consensus AGAACTTGTGAAATTGTTTAAAACTGNCAATTGGATCCTTGTAAGATG
 
. : . : . : . : . : . :
JMFS098C06+ CCCCTAGAACCTTGGGACCGTGTGTTTCCATAAGACGACCTAAATTTGTGCATTTAGCTT
JMSF051J09+ CCCCTAGAACCTTGGGACCGTGTGTTTCCATAAGACGACCTAAATTTGTGCATTTAGCTT
                      ____________________________________________________________
consensus CCCCTAGAACCTTGGGACCGTGTGTTTCCATAAGACGACCTAAATTTGTGCATTTAGCTT
 
. : . : . : . : . : . :
JMFS098C06+ CATCTCTGTAACAGGAAGGATACTAGCATTAGGTCACAAACAAATCATCAAGGTAATATT
JMSF051J09+ CATCTCTGTAACAGGAAGGATACTAGCATTAGGTCACAAACAAATCATCAAGGTAATATT
                      ____________________________________________________________
consensus CATCTCTGTAACAGGAAGGATACTAGCATTAGGTCACAAACAAATCATCAAGGTAATATT
 
. : . : . : . : . : . :
JMFS098C06+ ATCAAAAGTAACTATAATATAAAATATATTTCTATAATAAAATTTAAATTATATTCAAAA
JMSF051J09+ ATCAAAAGTAACTATAATATAAAATATATTTCTATAATAAAATTTAAATTATATTCAAAA
                      ____________________________________________________________
consensus ATCAAAAGTAACTATAATATAAAATATATTTCTATAATAAAATTTAAATTATATTCAAAA
 
. : . : . : . : . : . :
JMFS098C06+ TGTAGTTAAATCAGCTCGTTAAGTTACTAATTCAGTAAATTATACTCCGTATTTACTAAA
JMSF051J09+ TGTAGTTAAATCAGCTCGTTAAGTTACTAATTCAGTAAATTNTACTCCGTATTTACTAAA
                      ____________________________________________________________
consensus TGTAGTTAAATCAGCTCGTTAAGTTACTAATTCAGTAAATTATACTCCGTATTTACTAAA
 
. : . : . : . : . : . :
JMFS098C06+ TTAGCCGACACGAATCCAAATTAAGGTCGAGAGAAGGAGAAAGGGAAGTACAGAGAAGGG
JMSF051J09+ TTAGCCGACACGAATCCAAATTAAGGTCGAGAGAAGGAGAAAGGGAAGTACAGAGAAGGG
                      ____________________________________________________________
consensus TTAGCCGACACGAATCCAAATTAAGGTCGAGAGAAGGAGAAAGGGAAGTACAGAGAAGGG
 
. : . : . : . : . : . :
JMFS098C06+ AACCAAAAGAGAGGAGGGCCAAGAGAGGACTCATCGTAGTCATGGTAGACGGAGTAATAG
JMSF051J09+ AACCAAAAGAGAGGAGGGCCAAGAGAGGACTCATCGTAGTCATGGTAGACGGAGTAATAG
                      ____________________________________________________________
consensus AACCAAAAGAGAGGAGGGCCAAGAGAGGACTCATCGTAGTCATGGTAGACGGAGTAATAG
 
. : . : . : . : . : . :
JMFS098C06+ ATGAGCTGATGCAAGGCGTGCGGGTGCCAGGGCTTCAACAACTTCCGAGCTGTTATCTCC
JMSF051J09+ ATGAGCTGATGCAAGGCGTGCGGGTGCCAGGGCTTCAACAACTTCCGAGCTGTTATCTCC
                      ____________________________________________________________
consensus ATGAGCTGATGCAAGGCGTGCGGGTGCCAGGGCTTCAACAACTTCCGAGCTGTTATCTCC
 
. : . : . : . : . : . :
JMFS098C06+ CGCCACACCTCCTGCGGCTCCTCACCGGCGGCGGCATTGGCTCGAAGGCGACGGCGAGAC
JMSF051J09+ CGCCACACCTCCTGCGGCTCCTCACCGGCGGCGGCATTGGCTNGAAGGCGACGGCGAGAC
                      ____________________________________________________________
consensus CGCCACACCTCCTGCGGCTCCTCACCGGCGGCGGCATTGGCTCGAAGGCGACGGCGAGAC
 
. : . : . : . : . : . :
JMFS098C06+ AGAGCAACGGCGTCCTTGAGCTCTCCCTCCAGCAACGCCGCTTCCTCCGGCGCAAGTCCG
JMSF051J09+ AGAGCAACGGCGTCCTTGAGCTCTCCCTCCAGCAACGCCGCTTCCTCCGGCGCAAGTCCG
                      ____________________________________________________________
consensus AGAGCAACGGCGTCCTTGAGCTCTCCCTCCAGCAACGCCGCTTCCTCCGGCGCAAGTCCG
 
. : . : . : . : . : . :
JMFS098C06+ GCTCGCACCAGGTCCTCCGCTCCAACTCCGGCGATGCTC
JMSF051J09+ GCTCGCACCAGGTCCTCCGCTCCAACTCCGGCGATGCTCTTCCCCATTTTATCACTGTCC
                      ____________________________________________________________
consensus GCTCGCACCAGGTCCTCCGCTCCAACTCCGGCGATGCTCTTCCCCATTTTATCACTGTCC