Previous Contig 008064:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019G15Sequence539008064 (22)sp|P27154|CAPP_TOBAC6e-78Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho684002846 (4)gb:STPPC1_17228773e-85S.tuberosum ppc1 gene.
JMFF023O22Sequence430008064 (22)gb:AF248080_17806292e-38Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.708002846 (4)gb:STPPC1_17228771e-85S.tuberosum ppc1 gene.
JMFS012B03Sequence617008064 (22)sp|P27154|CAPP_TOBAC2e-73Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS019C11Sequence594008064 (22)sp|P27154|CAPP_TOBAC7e-76Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS020D11Sequence631008064 (22)sp|P27154|CAPP_TOBACe-102Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS049C03Sequence642008064 (22)sp|P27154|CAPP_TOBAC2e-86Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS077D11Sequence641008064 (22)sp|P27154|CAPP_TOBAC7e-85Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS080F05Sequence627008064 (22)sp|P27154|CAPP_TOBAC2e-97Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS085B06Sequence600008064 (22)sp|P27154|CAPP_TOBAC1e-76Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS102D01Sequence619008064 (22)sp|P27154|CAPP_TOBAC4e-90Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS115F06Sequence642008064 (22)sp|P27154|CAPP_TOBAC1e-82Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS119E03Sequence621008064 (22)sp|P27154|CAPP_TOBAC5e-87Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS120G05Sequence600008064 (22)sp|P27154|CAPP_TOBAC7e-78Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS125B12Sequence444008064 (22)gb:STPPC1_17228779e-79S.tuberosum ppc1 gene.
JMFS133D05Sequence615008064 (22)sp|P27154|CAPP_TOBAC2e-84Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS135D07Sequence369008064 (22)sp|P27154|CAPP_TOBAC7e-58Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS138C12Sequence597008064 (22)sp|P27154|CAPP_TOBAC2e-84Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS143H09Sequence624008064 (22)sp|P27154|CAPP_TOBAC4e-90Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS146D03Sequence614008064 (22)sp|P27154|CAPP_TOBAC1e-80Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS150H05Sequence480008064 (22)sp|P27154|CAPP_TOBAC2e-66Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho
JMFS167E07Sequence635008064 (22)gb:STPPC1_1722877e-116S.tuberosum ppc1 gene.
JMSF051J06Sequence675008064 (22)sp|P27154|CAPP_TOBAC1e-83Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|S17440|QYNT phospho755002846 (4)gb:STPPC1_17228771e-93S.tuberosum ppc1 gene.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS167E07+ TGGT
                      ____________________________________________________________
consensus TGGT
 
. : . : . : . : . : . :
JMFS167E07+ ATAGTTTATCCCTCACATCACCAAGAATAACACGGTACGGTTCATTTGGTGGAACTTGTT
                      ____________________________________________________________
consensus ATAGTTTATCCCTCACATCACCAAGAATAACACGGTACGGTTCATTTGGTGGAACTTGTT
 
. : . : . : . : . : . :
JMFS167E07+ TCCAAAACTCTATATAGTGTTTTGCATCTCTCCTCGATGACCGGTGAAGTTCATCTGCTC
                      ____________________________________________________________
consensus TCCAAAACTCTATATAGTGTTTTGCATCTCTCCTCGATGACCGGTGAAGTTCATCTGCTC
 
. : . : . : . : . : . :
JMFS167E07+ GAGCACGAAGCTCGTCATTGCACCGCCACATAGACATCTCAAACATAAGATCCTCGATTT
                      ____________________________________________________________
consensus GAGCACGAAGCTCGTCATTGCACCGCCACATAGACATCTCAAACATAAGATCCTCGATTT
 
. : . : . : . : . : . :
JMFS167E07+ GGGAATAGTACAAGTTTGTTGCCATCATTTTGGCTAGTAAGCAAACATCCCTTGTGACCT
JMFS125B12+ CAAACATCCCTTGTGACCT
                      ____________________________________________________________
consensus GGGAATAGTACAAGTTTGTTGCCATCATTTTGGCTAGTAAGCAAACATCCCTTGTGACCT
 
. : . : . : . : . : . :
JMFS167E07+ CGGGAGTCACCCGTGGATTTCCATCACGATCGCCACCCATCCAAGAGGAGAATTGAATCA
JMFS125B12+ CGGGAGTCACCCGTGGATTTCCATCACGATCGCCACCCATCCAAGAGGAGAATTGAATCA
                      ____________________________________________________________
consensus CGGGAGTCACCCGTGGATTTCCATCACGATCGCCACCCATCCAAGAGGAGAATTGAATCA
 
. : . : . : . : . : . :
JMFS167E07+ ACGGGGCATTGTAAGGAACACGTTCATTAATTCCTATGTTTTTAAGAGCTGTGTCAACAC
JMFS125B12+ ACGGGGCATTGTAAGGAACACGTTCATTAATTCCTATGTTTTTAAGAGCTGTGTCAACAC
                      ____________________________________________________________
consensus ACGGGGCATTGTAAGGAACACGTTCATTAATTCCTATGTTTTTAAGAGCTGTGTCAACAC
 
. : . : . : . : . : . :
JMFS167E07+ GTCGCAAAAACCTTGGAACGCCCTTCCAAATCGTCTCATGGAAGTAGCTCATCCCCGCTC
JMFS125B12+ GTCGCAAAAACCTTGGAACGCCCTTCCAAATCGTCTCATGGAAGTAGCTCATCCCCGCTC
                      ____________________________________________________________
consensus GTCGCAAAAACCTTGGAACGCCCTTCCAAATCGTCTCATGGAAGTAGCTCATCCCCGCTC
 
. : . : . : . : . : . :
JMFS167E07+ TCATTTCATCCTGGGGGGTCGGAGGAGTCCTTCGAATCTCATCAGTGCGGAAAGCAGCTT
JMFS125B12+ TCATTTCATCCTGGGGGGTCGGAGGAGTCCTTCGAATCTCATCAGTGCGGAAAGCAGCTT
                      ____________________________________________________________
consensus TCATTTCATCCTGGGGGGTCGGAGGAGTCCTTCGAATCTCATCAGTGCGGAAAGCAGCTT
 
. : . : . : . : . : . :
JMFS167E07+ GAATCTCCCTCTGCAAAGCCTCATCGAGCTCCTGTTTATCATCAGGTGTAATGTCTTTGT
JMFS125B12+ GAATCTCCCTCTGCAAAGCCTCATCGAGCTCCTGTTTATCATCAGGTGTAATGTCTTTGT
JMFS020D11+ TGTTTATCATCAGGTGTAATGTCTTTGT
JMFS080F05+ TCTTTGT
                      ____________________________________________________________
consensus GAATCTCCCTCTGCAAAGCCTCATCGAGCTCCTGTTTATCATCAGGTGTAATGTCTTTGT
 
. : . : . : . : . : . :
JMFS167E07+ TATACAGCTGAGCCAAACAATCCCGGATCCTTGCATGCTTTTGAAGCAATGATCTCCGGA
JMFS125B12+ TATACAGCTGAGCCAAACAATCCCGGATCCTTGCATGCTTTTGAAGCAATGATCTCCGGA
JMFS020D11+ TATACAGCTGAGCCAAACAATCCCGGATCCTTGCATGCTTTTGAAGCAATGATCTCCGGA
JMFS080F05+ TATACAGCTGAGCCAAACAATCCCGGATCCTTGCATGCTTTTGAAGCAATGATCTCCGGA
JMFS102D01+ GAGCCAAACAATCCCGGATCCTTGCATGC-TTTGAAGCAATGATCTCCGGA
JMFS143H09+ GAGCCAAACAATCCCGGATCCTTGCATGC-TTTGAAGCAATGATCTCCGGA
JMFS049C03+ CGGA
JMFS119E03+ CCGGA
JMSF051J06+ AAGCAATGATCTCCGGA
                      ____________________________________________________________
consensus TATACAGCTGAGCCAAACAATCCCGGATCCTTGCATGCTTTTGAAGCAATGATCTCCGGA
 
. : . : . : . : . : . :
JMFS167E07+ CAGATTGCGTAGGATGAGCAGTTAAAACAAG
JMFS125B12+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTATGGTTCTTCAATGCATCAA
JMFS020D11+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS080F05+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS102D01+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS143H09+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS115F06+ AGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS146D03+ AAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS120G05+ GTTCTTCAATGCATCAA
JMFS085B06+ TCAATGCATCAA
JMFS012B03+ AAGATCCCCCGTCTGG-TCTTCAATGCATCAA
JMFS077D11+ CGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS133D05+ GTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS138C12+ TAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS135D07+ TCAATGCATCAA
JMFF019G15+ GGTTCTTCAATGCATCAA
JMFS049C03+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS119E03+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
JMFS019C11+ TCAATGCATCAA
JMSF051J06+ CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
                      ____________________________________________________________
consensus CAGATTGCGTAGGATGAGCAGTTAAAACAAGATCCACCGTCTGGTTCTTCAATGCATCAA
 
. : . : . : . : . : . :
JMFS125B12+ ATACT
JMFS020D11+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS080F05+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS102D01+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS143H09+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS115F06+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS146D03+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS120G05+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS085B06+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS012B03+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS077D11+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS133D05+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS138C12+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS135D07+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFF019G15+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS049C03+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS119E03+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
JMFS150H05+ CAATGT
JMFS019C11+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTNTGAGGGTCTCTTCAATGT
JMSF051J06+ ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
                      ____________________________________________________________
consensus ATACTTCCTGAGGAGACTTCTTCATGTCCACCACAAGCCTTTTGAGGGTCTCTTCAATGT
 
. : . : . : . : . : . :
JMFS020D11+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS080F05+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS102D01+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS143H09+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS115F06+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS146D03+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS120G05+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS085B06+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS012B03+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTT-AGTTTCTGTCTCC
JMFS077D11+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS133D05+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS138C12+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS135D07+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFF019G15+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS049C03+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS119E03+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS150H05+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMFS019C11+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
JMSF051J06+ CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTC--TCTCC
                      ____________________________________________________________
consensus CGGATTCAGTTATTGCACTATTCTCGTCAACAAAATCCCCCTTCTTCAGTTTCTGTCTCC
 
. : . : . : . : . : . :
JMFS020D11+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS080F05+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS102D01+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS143H09+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS115F06+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS146D03+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS120G05+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS085B06+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFF023O22+ GCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAC
JMFS012B03+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS077D11+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS133D05+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS138C12+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS135D07+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFF019G15+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS049C03+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS119E03+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS150H05+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMFS019C11+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
JMSF051J06+ GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
                      ____________________________________________________________
consensus GACGATAGGCAATCTGAACCTCCTCGGCCAAGTTAGCCAAGTTAAGCATGTGAGAGAAAG
 
. : . : . : . : . : . :
JMFS020D11+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS080F05+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS102D01+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS143H09+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS115F06+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS146D03+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS120G05+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS085B06+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFF023O22+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS012B03+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS077D11+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS133D05+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS138C12+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS135D07+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFF019G15+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS049C03+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS119E03+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS150H05+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMFS019C11+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
JMSF051J06+ ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
                      ____________________________________________________________
consensus ATTTTGCAATCACGATGGAATCCCCCGGATCTAGACTTGTCAACACATTTCCAAGCTCCT
 
. : . : . : . : . : . :
JMFS020D11+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS080F05+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS102D01+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS143H09+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS115F06+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS146D03+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS120G05+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS085B06+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFF023O22+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS012B03+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS077D11+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS133D05+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS138C12+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS135D07+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFF019G15+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS049C03+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS119E03+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS150H05+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMFS019C11+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
JMSF051J06+ CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
                      ____________________________________________________________
consensus CCAGCTTCTTGGGGTCGTGCCTACCTTCATACTCGGCTGAGAGCTCATAACACTCTTGGA
 
. : . : . : . : . : . :
JMFS020D11+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS080F05+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS102D01+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS143H09+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS115F06+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS146D03+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS120G05+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS085B06+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFF023O22+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAGCCGATCCAGAA
JMFS012B03+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS077D11+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS133D05+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS138C12+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS135D07+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCA
JMFF019G15+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS049C03+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS119E03+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS150H05+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMFS019C11+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
JMSF051J06+ CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
                      ____________________________________________________________
consensus CCGTTTCCCTGAGATTCTCTCCATGCAAGTCCTGAAGAATATCAAGAAACCGATCCAGAA
 
. : . : . : . : . : . :
JMFS020D11+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS080F05+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS102D01+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS143H09+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS115F06+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS146D03+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS120G05+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS085B06+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFF023O22+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS012B03+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS077D11+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS133D05+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS138C12+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFF019G15+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS049C03+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS119E03+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS150H05+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMFS019C11+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
JMSF051J06+ GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
                      ____________________________________________________________
consensus GCAAAGCATCATACTCAACAAGCTTGTCATCCTCTGAGACCTTCCCGGGCACCAAAAGCC
 
. : . : . : . : . : . :
JMFS020D11+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS080F05+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS102D01+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS143H09+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS115F06+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS146D03+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS120G05+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS085B06+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFF023O22+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS012B03+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS077D11+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS133D05+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS138C12+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFF019G15+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS049C03+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS119E03+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS150H05+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMFS019C11+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
JMSF051J06+ TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
                      ____________________________________________________________
consensus TCAATTGGGCATCAATTGAGGCCATCTTCTCCAGATTTCGAGCAGCCATTTTCTCACTGT
 
. : . : . : . : . : . :
JMFS020D11+ CTG
JMFS080F05+ CTGCTCCACTCCACAACCCA
JMFS102D01+ CTGCTCCACTCCACAACCCACTTTTTAAC
JMFS143H09+ CTGCTCCACTCCACAACCCACTTTTTAACTATCT
JMFS115F06+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS146D03+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS120G05+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS085B06+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFF023O22+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS012B03+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS077D11+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS133D05+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS138C12+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFF019G15+ CTGCTCCACTCCACAACCCACTTTTTAACTATCT
JMFS049C03+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS119E03+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMFS150H05+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAA
JMFS019C11+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
JMSF051J06+ CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
                      ____________________________________________________________
consensus CTGCTCCACTCCACAACCCACTTTTTAACTATCTGAATCTGCAAATGGTAGAAAGAAAGA
 
. : . : . : . : . : . :
JMFS115F06+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAGTTGGGTGGGGCGTAG
JMFS146D03+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCA
JMFS120G05+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAG
JMFS085B06+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAGTTGGG
JMFF023O22+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTT
JMFS012B03+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAGTTGG
JMFS077D11+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAGTTGGG
JMFS133D05+ AAGCAAGAAAGAAGAAGATCAAT
JMFS138C12+ AAGCAA
JMFS049C03+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGG
JMFS119E03+ AAGCAAGAAAGAAGAA
JMFS019C11+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCA
JMSF051J06+ AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAGTTGGGTGGGGCGTAGTC
                      ____________________________________________________________
consensus AAGCAAGAAAGAAGAAGATCAATATTCAATAGCCTTGGGTCAGTTGGGTGGGGCGTAGTC