Previous Contig 008060:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020I18Sequence640008060 (3)gb:AY128395_15806946e-12Arabidopsis thaliana GTP-binding protein obg-like (At5g18570) mRNA, complete cds770013952 (3)gb:AY128395_15806941e-47Arabidopsis thaliana GTP-binding protein obg-like (At5g18570) mRNA, complete cds
JMSF021I18Sequence325008060 (3)gb:AY128395_15806940.041Arabidopsis thaliana GTP-binding protein obg-like (At5g18570) mRNA, complete cds672013952 (3)gb:AY128395_15806942e-38Arabidopsis thaliana GTP-binding protein obg-like (At5g18570) mRNA, complete cds
JMSF051I13Sequence646008060 (3)gb:AY128395_15806942e-15Arabidopsis thaliana GTP-binding protein obg-like (At5g18570) mRNA, complete cds747013952 (3)gb:AY128395_15806942e-44Arabidopsis thaliana GTP-binding protein obg-like (At5g18570) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020I18+ CAATGGCACAAACTTCTCTCTCCGAAACGCCACCACGCCGTTC
JMSF051I13+ CTCCCAATGGCACAAACTTCTCTCTCCGAAACGCCATCACGCCGTTC
                      ____________________________________________________________
consensus CTCCCAATGGCACAAACTTCTCTCTCCGAAACGCCATCACGCCGTTC
 
. : . : . : . : . : . :
JMSF020I18+ CCTCCATCCCCAGCTTTCACATATATCTTCGCTCTATCGAAACACCTCATCACCGCCGGC
JMSF051I13+ CCTCCATCCCCAGCTTTCACATATATCTTCGCTCTATCGAAACACCTCATCACCGCCGGC
                      ____________________________________________________________
consensus CCTCCATCCCCAGCTTTCACATATATCTTCGCTCTATCGAAACACCTCATCACCGCCGGC
 
. : . : . : . : . : . :
JMSF020I18+ ACGCCCTTCTCCTTTCTCCTTCACTTCCGCCCCTTCCCCTTCAAACACCCCATCCCCAAA
JMSF051I13+ ACGCCCTTCTCC-TTCTCCTTCACTTCCGCCCCTTCCCCTTCAAACACCCCATCCCCAAA
                      ____________________________________________________________
consensus ACGCCCTTCTCCTTTCTCCTTCACTTCCGCCCCTTCCCCTTCAAACACCCCATCCCCAAA
 
. : . : . : . : . : . :
JMSF020I18+ ACCTATGACTACGTCGTCGTTGTCGTCATCATCCTCATCATCACTTCCATCAAACTCATT
JMSF051I13+ ACCTATGACTACGTCGTCGTTGTCGTCATCATCCTCATCATCACTTCCATCAAACTCATT
                      ____________________________________________________________
consensus ACCTATGACTACGTCGTCGTTGTCGTCATCATCCTCATCATCACTTCCATCAAACTCATT
 
. : . : . : . : . : . :
JMSF020I18+ CTCTGAATCAACTTCATACAACTCAAACTTACCATAATCAAACCCTGAATTCTCCTCACT
JMSF051I13+ CTCTGAATCAACTTCATACAACTCAAACTTACCATAATCAAACCCTGAATTCTCCTCACT
                      ____________________________________________________________
consensus CTCTGAATCAACTTCATACAACTCAAACTTACCATAATCAAACCCTGAATTCTCCTCACT
 
. : . : . : . : . : . :
JMSF021I18+ CTGAACGGAATTNTTTCACTTCGAACGG
JMSF020I18+ TTCATCAATTTCCGAGAATTCGGCATCTTCCTCTGAACGGAATTCTTTCACTTCGAACGG
JMSF051I13+ TTCATCAATTTCCGAGAATTCGGCATCTTCCTCTGAACGGAATTCTTTCACTTCGAACGG
                      ____________________________________________________________
consensus TTCATCAATTTCCGAGAATTCGGCATCTTCCTCTGAACGGAATTCTTTCACTTCGAACGG
 
. : . : . : . : . : . :
JMSF021I18+ AATGCTGGACTCGTAGAGCCTGATTTCCTCCGAATTACGGGGAGGCGAGACGCAGAAGTC
JMSF020I18+ AATGCTGGACTCGTAGAGCCTGATTTCCTCCGAATTACGGGGAGGCGAGACGCAGAAGTC
JMSF051I13+ AATGCTGGACTCGTAGAGCCTGATTTCCTCCGAATTACGGGGAGGCGAGACGCAGAAGTC
                      ____________________________________________________________
consensus AATGCTGGACTCGTAGAGCCTGATTTCCTCCGAATTACGGGGAGGCGAGACGCAGAAGTC
 
. : . : . : . : . : . :
JMSF021I18+ TTCTTTCGGAGGTAGTCGAGTGTAAGTGGTAGCGGTGTCACCGGCGGAGGTAGAGAGCGG
JMSF020I18+ TTCTTTCGGAGGTAGTCGAGTGTAAGTGGTAGCGGTGTCACCGGCGGAGGTAGAGAGCGG
JMSF051I13+ TTCTTTCGGAGGTAGTCGAGTGTAAGTGGTAGCGGTGTCACCGGCGGAGGTAGAGAGCGG
                      ____________________________________________________________
consensus TTCTTTCGGAGGTAGTCGAGTGTAAGTGGTAGCGGTGTCACCGGCGGAGGTAGAGAGCGG
 
. : . : . : . : . : . :
JMSF021I18+ CGTTGGCGGCCGGAATTCACCGGACTTGAGAGTGCGGTGGTTGGATTTTCTTCTTCTGGT
JMSF020I18+ CGTTGGCGGCCGGAATTCACCGGACTTGAGAGTGCGGTGGTTGGATTTTCTTCTTCTGGT
JMSF051I13+ CGTTGGCGGCCGGAATTCACCGGACTTGAGAGTGCGGTGGTTGGATTTTCTTCTTCTGGT
                      ____________________________________________________________
consensus CGTTGGCGGCCGGAATTCACCGGACTTGAGAGTGCGGTGGTTGGATTTTCTTCTTCTGGT
 
. : . : . : . : . : . :
JMSF021I18+ GTTCGTTAACACTCGTTTAGGGTTGGGCGTTCGAGCCNGGCAGCGAAGAGAGAAGTAGGA
JMSF020I18+ GTTCGTTAACACTCGTTTAGGGTTGGGCGTTCGAGCCTGGCAGCGAAGAGAGAAGTAGGA
JMSF051I13+ GTTCGTTAACACTCGTTTAGGGTTGGGCGTTCGAGCCTGGCAGCGAAGAGAGAAGTAGGA
                      ____________________________________________________________
consensus GTTCGTTAACACTCGTTTAGGGTTGGGCGTTCGAGCCTGGCAGCGAAGAGAGAAGTAGGA
 
. : . : . : . : . : . :
JMSF021I18+ TAGAGAAGTAGCGGAGAGAGAGGCAGCCGCCATGTTTAGCTCAGAGCATTCCCGCC
JMSF020I18+ TAGAGAAGTAGCGGAGAGAGAGGCAGCCGCCATGTTTAGCTCAGAGCATTCCCGCC
JMSF051I13+ TAGAGAAGTAGCGGAGAGAGAGGCAGCCGCCATGTTTAGCTCAGAGCATTCCCGCCGCTC
                      ____________________________________________________________
consensus TAGAGAAGTAGCGGAGAGAGAGGCAGCCGCCATGTTTAGCTCAGAGCATTCCCGCCGCTC