Previous Contig 008049:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015F17Sequence594008049 (3)sp|Q8GZ43|YZR3_ARATH2e-55Hypothetical RANBP2-type zinc-finger protein At1g67325.>gb:BT005282_1638222 Arab
JMSF051G02Sequence673008049 (3)sp|Q8GZ43|YZR3_ARATH1e-62Hypothetical RANBP2-type zinc-finger protein At1g67325.>gb:BT005282_1638222 Arab723008049 (3)pir|G96696|G966962e-40protein F1N21.14 [imported] - Arabidopsis thaliana>gb:AE005173_894354 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051G02- TGGATTCCTAGAAGNGTTACNGTTCAAACAAGAAATTTGACCTAAATACAGCNG
                      ____________________________________________________________
consensus TGGATTCCTAGAAGNGTTACNGTTCAAACAAGAAATTTGACCTAAATACAGCNG
 
. : . : . : . : . : . :
rJMSF051G02- GCNGCTTAGACTTCTATAAAGACCTAATTTAATTAGAGANGGAGAACCAGCAATCCTATT
                      ____________________________________________________________
consensus GCNGCTTAGACTTCTATAAAGACCTAATTTAATTAGAGANGGAGAACCAGCAATCCTATT
 
. : . : . : . : . : . :
rJMSF051G02- GAACATTAATCAAATCAATCTTAACAATATACTTCCATCANACTNGGCANATATGCAACT
                      ____________________________________________________________
consensus GAACATTAATCAAATCAATCTTAACAATATACTTCCATCANACTNGGCANATATGCAACT
 
. : . : . : . : . : . :
rJMSF051G02- CAATAANAATCCNCAAGGACCACGGAATATCAATTTCAGTTAATACAAAAGTTGACNCCA
                      ____________________________________________________________
consensus CAATAANAATCCNCAAGGACCACGGAATATCAATTTCAGTTAATACAAAAGTTGACNCCA
 
. : . : . : . : . : . :
rJMSF051G02- TAATAAGGTAAGAGTAAACTCAATAACNGCTGCAACATGACCGACNGNGAGACACACTGA
                      ____________________________________________________________
consensus TAATAAGGTAAGAGTAAACTCAATAACNGCTGCAACATGACCGACNGNGAGACACACTGA
 
. : . : . : . : . : . :
rJMSF051G02- GCAANGCTGGACGACAACTCTGGACCTTCCCAACCATTAAAACATGCCCTAGTACTCACN
                      ____________________________________________________________
consensus GCAANGCTGGACGACAACTCTGGACCTTCCCAACCATTAAAACATGCCCTAGTACTCACN
 
. : . : . : . : . : . :
rJMSF051G02- GATCATTTTCATCTGTTGGTTGNGGAGGANACTCTTTTGGCTCGGANGGTTTTTCAGCAC
                      ____________________________________________________________
consensus GATCATTTTCATCTGTTGGTTGNGGAGGANACTCTTTTGGCTCGGANGGTTTTTCAGCAC
 
. : . : . : . : . : . :
rJMSF051G02- CACAGTTNGGTCTATTACACTTGGNCCTAAANGGATAGTTTATATNGTTGCACTTCTCAC
                      ____________________________________________________________
consensus CACAGTTNGGTCTATTACACTTGGNCCTAAANGGATAGTTTATATNGTTGCACTTCTCAC
 
. : . : . : . : . : . :
rJMSF051G02- ACTTCCAACTCCCTTCNGGCATATTANAACTCTTCCCANATTTAGCACCCNGGGATCCAG
                      ____________________________________________________________
consensus ACTTCCAACTCCCTTCNGGCATATTANAACTCTTCCCANATTTAGCACCCNGGGATCCAG
 
. : . : . : . : . : . :
rJMSF051G02- GCTNGGGNGTATTGCATTTCCTCATATTACAAATTGTTCTAAACGAAAAATTGACATTTC
                      ____________________________________________________________
consensus GCTNGGGNGTATTGCATTTCCTCATATTACAAATTGTTCTAAACGAAAAATTGACATTTC
 
. : . : . : . : . : . :
rJMSF051G02- CACATTTAGGACATGTCCAGTCATTATCACGGGTTCCATCTTTATTTTGAGATTTATCCT
JMSF051G02+ TGAGATTTATCNT
                      ____________________________________________________________
consensus CACATTTAGGACATGTCCAGTCATTATCACGGGTTCCATCTTTATTTTGAGATTTATCCT
 
. : . : . : . : . : . :
rJMSF051G02- CTGGGAAAAATCCTGGCCTTGGGCCCATCGCAAAATGACCCATAGGCAACCCAAGGCCAT
JMSF051G02+ CTGGGAAAAATCCTGGCCTTGGGCCCATCGCAGAATGACCCATAGGCAACCCAAGGCCAT
                      ____________________________________________________________
consensus CTGGGAAAAATCCTGGCCTTGGGCCCATCGCAGAATGACCCATAGGCAACCCAAGGCCAT
 
. : . : . : . : . : . :
rJMSF051G02- ATCTTTCCA
JMFF015F17+ TCCATTATTGGTGGAGGCACTCCATAAATTCCACCAGTTCCAATCATAGTTCCAC
JMSF051G02+ ATCTTTCCATTATTGGTGGAGGCACTCCATAAATTCCACCAGTTCCAATCATAGTTCCAC
                      ____________________________________________________________
consensus ATCTTTCCATTATTGGTGGAGGCACTCCATAAATTCCACCAGTTCCAATCATAGTTCCAC
 
. : . : . : . : . : . :
JMFF015F17+ CGGAATACGGAGGTGGACCAGATAAATGCAAGTGTCGGAATGGACTGCCTCCAGAAAGAC
JMSF051G02+ CGGAATACGGAGGTGGACCAGATAAATGCAAGTGTCGGAATGGACTGCCTCCAGAAAGAC
                      ____________________________________________________________
consensus CGGAATACGGAGGTGGACCAGATAAATGCAAGTGTCGGAATGGACTGCCTCCAGAAAGAC
 
. : . : . : . : . : . :
JMFF015F17+ GACTGCCATAGTTGTAATGATATGCTGATTCTCCAGGAAAAGGAACATCATAAGGAGGCA
JMSF051G02+ GACTGCCATAGTTGTAATGATATGCTGATTCTCCAGGAAAAGGAACATCATAAGGAGGCA
                      ____________________________________________________________
consensus GACTGCCATAGTTGTAATGATATGCTGATTCTCCAGGAAAAGGAACATCATAAGGAGGCA
 
. : . : . : . : . : . :
JMFF015F17+ AAGATGTTCCATTAAACACAGATGTACCATAAGGTGGTATACCCATATACATTGAAGATG
JMSF051G02+ AAGATGTTCCATTAAACACAGATGTACCATAAGGTGGTATACCCATATACATTGAAGATG
                      ____________________________________________________________
consensus AAGATGTTCCATTAAACACAGATGTACCATAAGGTGGTATACCCATATACATTGAAGATG
 
. : . : . : . : . : . :
JMFF015F17+ GAGCAGCAGAAACTACATATGGAGCCGATGTTGAATAGGCTTGTGGTGGGTGCATGGGCT
JMSF051G02+ GAGCAGCAGAAACTACATATGGAGCCGATGTTGAATAGGCTTGTGGTGGGTGCATGGGCT
                      ____________________________________________________________
consensus GAGCAGCAGAAACTACATATGGAGCCGATGTTGAATAGGCTTGTGGTGGGTGCATGGGCT
 
. : . : . : . : . : . :
JMFF015F17+ TAGCTAGAGATTTAGAGTTGTGATCGGCAGGCCTAGGTTGGGTACAGTTCCGCATATTGC
JMSF051G02+ TAGCTAGAGATTTAGAGTTGTGATCGGCAGGCCTAGGTTGGGTACAGTTCCGCATATTGC
                      ____________________________________________________________
consensus TAGCTAGAGATTTAGAGTTGTGATCGGCAGGCCTAGGTTGGGTACAGTTCCGCATATTGC
 
. : . : . : . : . : . :
JMFF015F17+ AGGTAGTTCTAAATGAGAAATTAACATTGCCACAACTGGGGCATGTCCAATCATCTTCTC
JMSF051G02+ AGGTAGTTCTAAATGAGAAATTAACATTGCCACAACTGGGGCATGTCCAATCATCTTCTC
                      ____________________________________________________________
consensus AGGTAGTTCTAAATGAGAAATTAACATTGCCACAACTGGGGCATGTCCAATCATCTTCTC
 
. : . : . : . : . : . :
JMFF015F17+ TACGCCCACCATCTGTTCGGGCTCTTTTAGCTGCTGAAGAATTCCTATTATCTACCTGAG
JMSF051G02+ TACGCCCACCATCTGTTCGGGCTCTTTTAGCTGCTGAAGAATTCCTATTATCTACCTGAG
                      ____________________________________________________________
consensus TACGCCCACCATCTGTTCGGGCTCTTTTAGCTGCTGAAGAATTCCTATTATCTACCTGAG
 
. : . : . : . : . : . :
JMFF015F17+ ACATCTCAGAATTTAATTAGAGAAAATGGGCAAAGATCCTTTGGCTTCCCCTTCAACGTT
JMSF051G02+ ACATCTCAGAATTTAATTAGAGAAAATGGGCAAAGATCCTTTGGCTTCCCCTTCAACGTT
                      ____________________________________________________________
consensus ACATCTCAGAATTTAATTAGAGAAAATGGGCAAAGATCCTTTGGCTTCCCCTTCAACGTT
 
. : . : . : . : . : . :
JMFF015F17+ GCAGTGCTGGAGACCTTCGAGGAGAGGCGATGCCGCTAAGGCCTACGGGTAGGGT
JMSF051G02+ GCAGTGCTGGAGACCTTCGAGGAGAGGCGATGCCGCTAAGGCCTACGGGTAGGGTTTTCC
                      ____________________________________________________________
consensus GCAGTGCTGGAGACCTTCGAGGAGAGGCGATGCCGCTAAGGCCTACGGGTAGGGTTTTCC