Previous Contig 008043:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS080D07Sequence535008043 (3)gb:AB022214_15150052e-28Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5F14.
JMFS147D08Sequence619008043 (3)gb:AB022214_15150055e-26Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5F14.
JMSF051E21Sequence632008043 (3)gb:AB022214_15150057e-26Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5F14.731024459pir|C85065|C850657e-80kinesin-like protein [imported] - Arabidopsis thaliana>gb:ATCHRIV15_1544363 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS080D07+ GGGCTTCCGATTTTTCAG
JMFS147D08+ GGGCTTCCGATTTTTCAG
JMSF051E21+ ACTAAGAGAATTAAGGGCTTCCGATTTTTCAG
                      ____________________________________________________________
consensus ACTAAGAGAATTAAGGGCTTCCGATTTTTCAG
 
. : . : . : . : . : . :
JMFS080D07+ ATTCCTCCTTCTTCAAATTGTCCTGTAACACAGCAATATTTTTCCTCAACTCCATAATGA
JMFS147D08+ ATTCCTCCTTCTTCAAATTGTCCTGTAACACAGCAATATTTTTCCTCAACTCCATAATGA
JMSF051E21+ ATTCCTCCTTCTTCAAATTGTCCTGTAACACAGCAATATTTTTCCTCAACTCCATAATGA
                      ____________________________________________________________
consensus ATTCCTCCTTCTTCAAATTGTCCTGTAACACAGCAATATTTTTCCTCAACTCCATAATGA
 
. : . : . : . : . : . :
JMFS080D07+ TTGCATTCAATTCCTCTTCCTTTGATTTCATTAGCATATCCATCTCGCTGCACCTCTTCT
JMFS147D08+ TTGCATTCAATTCCTCTTCCTTTGATTTCATTAGCATATCCATCTCGCTGCACCTCTTCT
JMSF051E21+ TTGCATTCAATTCCTCTTCCTTTGATTTCATTAGCATATCCATCTCGCTGCACCTCTTCT
                      ____________________________________________________________
consensus TTGCATTCAATTCCTCTTCCTTTGATTTCATTAGCATATCCATCTCGCTGCACCTCTTCT
 
. : . : . : . : . : . :
JMFS080D07+ CTGCTGATTCTAGCAAGCTTTTGAGTGACTCCTGTTCAGAAATATAGTTTCCCTCAAGCT
JMFS147D08+ CTGCTGATTCTAGCAAGCTTTTGAGTGACTCCTGTTCAGAAATATAGTTTCCCTCAAGCT
JMSF051E21+ CTGCTGATTCTAGCAAGCTTTTGAGTGACTCCTGTTCAGAAATATAGTTTCCCTCAAGCT
                      ____________________________________________________________
consensus CTGCTGATTCTAGCAAGCTTTTGAGTGACTCCTGTTCAGAAATATAGTTTCCCTCAAGCT
 
. : . : . : . : . : . :
JMFS080D07+ GTTGGAACCACCTAATGCACTGCTTAAGCCTTCTAATATATTCCGACATTTGATCACATT
JMFS147D08+ GTTGGAACCACCTAATGCACTGCTTAAGCCTTCTAATATATTCCGACATTTGATCACATT
JMSF051E21+ GTTGGAACCACCTAATGCACTGCTTAAGCCTTCTAATATATTCCGACATTTGATCACATT
                      ____________________________________________________________
consensus GTTGGAACCACCTAATGCACTGCTTAAGCCTTCTAATATATTCCGACATTTGATCACATT
 
. : . : . : . : . : . :
JMFS080D07+ TTTCCTTCATATTATACTTGTTCTTAGTTTTCAGCTTCTCAACTAGCAATGCTTCAACAT
JMFS147D08+ TTTCCTTCATATTATACTTGTTCTTAGTTTTCAGCTTCTCAACTAGCAATGCTTCAACAT
JMSF051E21+ TTTCCTTCATATTATACTTGTTCTTAGTTTTCAGCTTCTCAACTAGCAATGCTTCAACAT
                      ____________________________________________________________
consensus TTTCCTTCATATTATACTTGTTCTTAGTTTTCAGCTTCTCAACTAGCAATGCTTCAACAT
 
. : . : . : . : . : . :
JMFS080D07+ CTTCCTTGTTAAACTCAATAACTCCACAATCTGAGCCAGCACTACTTGGCGGTCCACTGG
JMFS147D08+ CTTCCTTGTTAAACTCAATAACTCCACAATCTGAGCCAGCACTACTTGGCGGTCCACTGG
JMSF051E21+ CTTCCTTGTTAAACTCAATAACTCCACAATCTGAGCCAGCACTACTTGGCGGTCCACTGG
                      ____________________________________________________________
consensus CTTCCTTGTTAAACTCAATAACTCCACAATCTGAGCCAGCACTACTTGGCGGTCCACTGG
 
. : . : . : . : . : . :
JMFS080D07+ TTGGAGGCAGATCTGCACTCCCATTTACCACAGCAAACGCCTGTCTACCAGGTCTAACTC
JMFS147D08+ TTGGAGGCAGATCTGCACTCCCATTTACCACAGCAAACGCCTGTCTACCAGGTCTAACTC
JMSF051E21+ TTGGAGGCAGATCTGCACTCCCATTTACCACAGCAAACGCCTGTCTACCAGGTCTAACTC
                      ____________________________________________________________
consensus TTGGAGGCAGATCTGCACTCCCATTTACCACAGCAAACGCCTGTCTACCAGGTCTAACTC
 
. : . : . : . : . : . :
JMFS080D07+ CAGACGGCATCTTTGGATTCCCAATCTTTCTTTTCTTATCTACTGACACCTCATCCACTG
JMFS147D08+ CAGACGGCATCTTTGGATTCCCAATCTTTCTTTTCTTATCTACTGACACCTCATCCACTG
JMSF051E21+ CAGACGGCATCTTTGGATTCCCAATCTTTCTTTTCTTATCTACTGACACCTCATCCACTG
                      ____________________________________________________________
consensus CAGACGGCATCTTTGGATTCCCAATCTTTCTTTTCTTATCTACTGACACCTCATCCACTG
 
. : . : . : . : . : . :
JMFS080D07+ TGAACTTTCCGTTGGATGGACTCGAAGGAGTTGGAGC
JMFS147D08+ TGAACTTTCCGTTGGATGGACTCGAAGGAGTTGGAGCTACAGGAGGCTTATTCTGGCTCT
JMSF051E21+ TGAACTTTCCGTTGGATGGACTCGAAGGAGTTGGAGCTACAGGAGGCTTATTCTGGCTCT
                      ____________________________________________________________
consensus TGAACTTTCCGTTGGATGGACTCGAAGGAGTTGGAGCTACAGGAGGCTTATTCTGGCTCT
 
. : . : . : . : . : . :
JMFS147D08+ TGGGAGCCATTTGAAAGTGAGCGCAATTATGGAAGGAGATGTAGAGAGAGAAACAG
JMSF051E21+ TGGGAGCCATTTGAAAGTGAGCGCAATTATGGAAGGAGATGTAGAGAGAGAAACAGCACC
                      ____________________________________________________________
consensus TGGGAGCCATTTGAAAGTGAGCGCAATTATGGAAGGAGATGTAGAGAGAGAAACAGCACC