Previous Contig 008040:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016B13Sequence573014379gb:AY062693_15653493e-13Arabidopsis thaliana similar to valyl tRNA synthetase (At1g14610; T5E21.11) mRNA557008040 (7)gb:CPL491254_16486552e-39Craterostigma plantagineum mRNA for transcription factor R18 (r18 gene).
JMFN032G02Sequence618008040 (7)gb:AB079499_15239021e-21Nicotiana benthamiana NbrbohB mRNA for respiratory burst oxidase homolog, comple
JMFN035I21Sequence630008040 (7)gb:CPL491254_16486551e-26Craterostigma plantagineum mRNA for transcription factor R18 (r18 gene).
JMSF051D09Sequence660008040 (7)gb:AF147783_17723122e-22Lycopersicon esculentum whitefly-induced gp91-phox (Wfi1) gene, complete cds.>gb699008040 (7)gb:CPL491254_16486554e-32Craterostigma plantagineum mRNA for transcription factor R18 (r18 gene).
JMSF052D09Sequence662008040 (7)gb:AF147783_17723121e-22Lycopersicon esculentum whitefly-induced gp91-phox (Wfi1) gene, complete cds.>gb433008040 (7)gb:CPL491254_16486552e-24Craterostigma plantagineum mRNA for transcription factor R18 (r18 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016B13- AATGAAC
                      ____________________________________________________________
consensus AATGAAC
 
. : . : . : . : . : . :
rJMFF016B13- TCCCACTTTTACAGCACAAATACATAAGTCCCTATTGGTAACCAGTTTTATGATCTCTTC
rJMSF051D09- AAATACATAAGTCCCTATTGGTAACCAGTTTTATGATCTCTTC
                      ____________________________________________________________
consensus TCCCACTTTTACAGCACAAATACATAAGTCCCTATTGGTAACCAGTTTTATGATCTCTTC
 
. : . : . : . : . : . :
rJMFF016B13- TATTTTTTTATTTTTTTTTTAANAAGGTGCAAAATACATAAACAGNGGCTANAAGGTTTT
rJMSF051D09- TATTTTTTTATTTTTTTTTTAAGAAGGGGCAAAATACATAAACNGGGGCTAGAAGGTTTT
                      ____________________________________________________________
consensus TATTTTTTTATTTTTTTTTTAAGAAGGTGCAAAATACATAAACAGGGGCTAGAAGGTTTT
 
. : . : . : . : . : . :
rJMFF016B13- AAACTTCATATGAATGTGAAATCATTTCTTGGTTCANCATGCCATANCTCTCTTTTACAA
rJMSF052D09- GCCATAGCTCTCTTTTACAA
rJMSF051D09- AAACTTCATATGAANGNGAATTCATTTCTNGGTTCAGCANGCCATAGCTCTCTTTTACAA
                      ____________________________________________________________
consensus AAACTTCATATGAATGTGAATTCATTTCTTGGTTCAGCATGCCATAGCTCTCTTTTACAA
 
. : . : . : . : . : . :
rJMFF016B13- TTCTTCCTGCAACAACCCTTGTACCGCATGGAGGAGGAGCACTACCGCTCCTGGAAGCAA
rJMSF052D09- TTCTTCCNGCAACAACCCTNGTACCGCANGGAGGAGGAGCACTAGCGCNCCNGGAAGNAA
rJMSF051D09- TTCTTCCNGCAACAACCCTTGTACCGCAGGGAGGAGGAGCACTAGCGCTCCNGGAAGCAA
JMFN035I21+ GGAAGCAA
                      ____________________________________________________________
consensus TTCTTCCTGCAACAACCCTTGTACCGCATGGAGGAGGAGCACTAGCGCTCCTGGAAGCAA
 
. : . : . : . : . : . :
rJMFF016B13- TATTGAACATTTCATATACATTTGTTCAAACAAAACAACATCTTCAGTGCATGCATCACC
rJMSF052D09- TATTGAACATTTCATATACATTNGTTCAAACAAAACAACATCTTCNGGGCANGCATCACC
rJMSF051D09- TATTGAACATTTCATATACATTTGTTCAAACAAAACAACATCTTCAGNGCANGCATCACC
JMFN035I21+ TATTGAACATTTCATATACA-TTGTTCAAACAAAACAACATCTTCAGTGCATGCATCACC
                      ____________________________________________________________
consensus TATTGAACATTTCATATACATTTGTTCAAACAAAACAACATCTTCAGTGCATGCATCACC
 
. : . : . : . : . : . :
rJMFF016B13- TTTGCAGT-TCCATACAAAACTAGATACAGGATACTTCTTCTCTCCACCACCATTGACAA
rJMSF052D09- TTTGCAGT-TCCATACAAAACTANATACAGGATACTTCTTCTCTCCACCACCATNGANAA
rJMSF051D09- TTTGCAGT-TCCATACAAAACTAGATACAGGATACTTCTTCTCTCCACCACCATTGACAA
JMFN035I21+ -TTGCAGTNTCCATACAAAACTAGATACAGGATACTTCTTCTCTCCACCACCATTGACAA
                      ____________________________________________________________
consensus TTTGCAGT-TCCATACAAAACTAGATACAGGATACTTCTTCTCTCCACCACCATTGACAA
 
. : . : . : . : . : . :
rJMFF016B13- CATCAATATGCTCCTTGATACNCTCAATAAACGTAGCCTTGTTGCCCGTCAATCTCAATC
rJMSF052D09- CATCAATANGCTCCTNGATACGCNCAANAAACGNANCCTNGTNGCCCGTCAANCNCAATC
rJMSF051D09- CATCAATATGCTCCTTGATACGCTCAATAAACGTAGCCTTGTTGCCCGTCAATCTCAATC
JMFN035I21+ CATCAATATGCTCCTTGATACGCTCAATAAACGTAGCCTTGTTGCCCGTCAATCTCAATC
                      ____________________________________________________________
consensus CATCAATATGCTCCTTGATACGCTCAATAAACGTAGCCTTGTTGCCCGTCAATCTCAATC
 
. : . : . : . : . : . :
rJMFF016B13- CATGCTTCCTTAAATAGACCTTGCACTGATCAATTTTCAGCTTTTCAATCTCACCACCAT
rJMSF052D09- CNNGCTNCCTTAAATAGACCTTGCNCNGANCAATTTTCAGCTTTTCAATCTCACCANCNT
rJMSF051D09- CANGCTTCCTTAAATAGACCTTGCACNGATCAATTTTCAGCTTTTCAATCTCACCAGCAT
JMFN035I21+ CATGCTTCCTTAAATAGACCTTGCACTGATCAATTTTCAGCTTTTCAATCTCACCAGCAT
                      ____________________________________________________________
consensus CATGCTTCCTTAAATAGACCTTGCACTGATCAATTTTCAGCTTTTCAATCTCACCAGCAT
 
. : . : . : . : . : . :
rJMFF016B13- TCAAAGGGAGAAACTGCAAAACAGTTGACAAACATGTATTGACCACTTCGGTATCTGAAC
rJMSF052D09- TCAAAGGGANAANCNGCNNAACAGTNGACAAACATGTATNGACCACTTCGGTANCTGAAC
rJMSF051D09- TCAAAGGGAGAAACNGCANAACAGTTGACAAACATGTATTGACCACTTCGGTATCTGAAC
JMFN035I21+ TCAAAGGGAGAAACTGCAGAACAGTTGACAAACATGTATTGACCACTTCGGTATCTGAAC
                      ____________________________________________________________
consensus TCAAAGGGAGAAACTGCAGAACAGTTGACAAACATGTATTGACCACTTCGGTATCTGAAC
 
. : . : . : . : . : . :
rJMFF016B13- CCC
rJMSF052D09- CCC
rJMSF051D09- CCCNGNGGCTNGGACATATGAAGGGACAAAACATTTCCAGAATAGA-------CTTAAGA
JMFN035I21+ CCCTGTGGCTTGGACATATGAAGGGACAAAACATTTCCAGAATAGACTGCCACCTTAAGA
                      ____________________________________________________________
consensus CCCTGTGGCTTGGACATATGAAGGGACAAAACATTTCCAGAATAGACTGCCACCTTAAGA
 
. : . : . : . : . : . :
rJMSF051D09- ATCTTGACAGGCTTAATGCTAAATCTGAATGATCTGAGCAGTTTTTCACAAGCATAAATT
JMFN035I21+ ATCTTGACAGGCTTAATGCTAAATCTGAATGATCTGAGCAGTTTTTCACAAGCATAAATT
JMFN032G02+ GGCTTAATGCTAAATCTGAATGATCTGAGCAGTTTTTCACAAGCATAAATT
                      ____________________________________________________________
consensus ATCTTGACAGGCTTAATGCTAAATCTGAATGATCTGAGCAGTTTTTCACAAGCATAAATT
 
. : . : . : . : . : . :
rJMSF051D09- ACCATGGGAACAGCCAAGTACATCCATGTC
JMFN035I21+ ACCATGGGAACAGCCAAGTACATCCATGTCTGTCATCACAACTTCATCATCTCAGGGCTC
JMFN032G02+ ACCATGGGAACAGCCAAGTACATCCATGTCTGTCATCACAACTTCATCATCTCAGGGCTC
                      ____________________________________________________________
consensus ACCATGGGAACAGCCAAGTACATCCATGTCTGTCATCACAACTTCATCATCTCAGGGCTC
 
. : . : . : . : . : . :
JMFN035I21+ GCGTGTATCAGCTTTGGGAAATCACACGTCAAGTGAGCTATTGCCTGTATTCCCACACCA
JMFN032G02+ GCGTGTATCAGCTTTGGGAAATCACACGTCAAGTGAGCTATTGCCTGTATTCCCACACCA
                      ____________________________________________________________
consensus GCGTGTATCAGCTTTGGGAAATCACACGTCAAGTGAGCTATTGCCTGTATTCCCACACCA
 
. : . : . : . : . : . :
JMFN035I21+ ATCGCCACAGCCACCGCGATCACTTTGTGAAAATTAAGGTTGTCATCAAAAGGGACCGCG
JMFN032G02+ ATCGCCACAGCCACCGCGATCACTTTGTGAAAATTAAGGTTGTCATCAAAAGGGACCGCG
JMSF052D09+ ATCGCCACAGCCACCGCGATCACTTTGTGAAAATTAAGGTTGTCATCAAAAGGGACCGCG
JMSF051D09+ ATCGCCACAGCCACCGCGATCACTTTGTGAAAATTAAGGTTGTCATCAAAAGGGACCGCG
                      ____________________________________________________________
consensus ATCGCCACAGCCACCGCGATCACTTTGTGAAAATTAAGGTTGTCATCAAAAGGGACCGCG
 
. : . : . : . : . : . :
JMFN035I21+ ACGCCTAACTTGGTCAGTTGGTC
JMFN032G02+ ACGCCTAACTTGGTCAGTTGGTCTTGTTCCTGAGCCAGGTGATGGTGTTCCTGCGGXXXX
JMSF052D09+ ACGCCTAACTTGGTCAGTTGGTCTTGTTCCTGAGCCAGGTGATGGTGTTCCTGCGGACTG
JMSF051D09+ ACGCCTAACTTGGTCAGTTGGTCTTGTTCCTGAGCCAGGTGATGGTGTTCCTGCGGACTG
                      ____________________________________________________________
consensus ACGCCTAACTTGGTCAGTTGGTCTTGTTCCTGAGCCAGGTGATGGTGTTCCTGCGGACTG
 
. : . : . : . : . : . :
JMFN032G02+ XXXXXXXXXXXXTGGCCATGTTGAGCTTCAGTGTTTCTGCAGCACCTTTGGCCAAACAAA
JMSF052D09+ GTAACAGGATTATGGCCATGTTGAGCTTCAGTGTTTCTGCAGCACCTTTGGCCAAACAAA
JMSF051D09+ GTAACAGGATTATGGCCATGTTGAGCTTCAGTGTTTCTGCAGCACCTTTGGCCAAACAAA
                      ____________________________________________________________
consensus GTAACAGGATTATGGCCATGTTGAGCTTCAGTGTTTCTGCAGCACCTTTGGCCAAACAAA
 
. : . : . : . : . : . :
JMFN032G02+ CGCAGACGCCCATAACGCAATACGCAGCTCACCTTTCAAATCTTTCTTTTGGAGGCAGCA
JMSF052D09+ CGCAGACGCCCATAACGCAATACGCAGCTCACCTTTCAAATCTTTCTTTTGGAGGCAGCA
JMSF051D09+ CGCAGACGCCCATAACGCAATACGCAGCTCACCTTTCAAATCTTTCTTTTGGAGGCAGCA
                      ____________________________________________________________
consensus CGCAGACGCCCATAACGCAATACGCAGCTCACCTTTCAAATCTTTCTTTTGGAGGCAGCA
 
. : . : . : . : . : . :
JMFN032G02+ ATGCCCTCTTTGACCGCAGCCCTTTTACTATAGATGTTACCTTTTCCATCTCATCTTCAA
JMSF052D09+ ATGCCCTCTTTGACCGCAGCCCTTTTACTATAGATGTTACCTTTTCCATCTCATCTTCAA
JMSF051D09+ ATGCCCTCTTTGACCGCAGCCCTTTTACTATAGATGTTACCTTTTCCATCTCATCTTCAA
                      ____________________________________________________________
consensus ATGCCCTCTTTGACCGCAGCCCTTTTACTATAGATGTTACCTTTTCCATCTCATCTTCAA
 
. : . : . : . : . : . :
JMFN032G02+ CTTTATCATTATTCCAGCTCT
JMSF052D09+ CTTTATCATTATTCCAGCTCTATCTACACCACCGCGGCCTCCTCGCTGGTCAATCGCCAC
JMSF051D09+ CTTTATCATTATTCCAGCTCTATCTACACCACCGCGGCCTCCTCGCTGGTCAATCGCCAC
                      ____________________________________________________________
consensus CTTTATCATTATTCCAGCTCTATCTACACCACCGCGGCCTCCTCGCTGGTCAATCGCCAC
 
. : . : . : . : . : . :
JMSF052D09+ CTCGCCACCACCAATCGAGGACCTCGCCTGTTGGTCGCCGCTGCCTCGCTCACTATCCTC
JMSF051D09+ CTCGCCACCACCAATCGAGGACCTCGCCTGTTGGTCGCCGCTGCCTCGCTCACTATCCTC
                      ____________________________________________________________
consensus CTCGCCACCACCAATCGAGGACCTCGCCTGTTGGTCGCCGCTGCCTCGCTCACTATCCTC
 
. : . : . : . : . : . :
JMSF052D09+ GTCGCAGCCGTAGGAACTCCAAGTCTCCAGGAAGGCGGAAGCATAAAGAAATTAATTGTT
JMSF051D09+ GTCGCAGCCGTAGGAACTCCAAGTCTCCAGGAAGGCGGAAGCATAAAGAAATTAATTGTT
                      ____________________________________________________________
consensus GTCGCAGCCGTAGGAACTCCAAGTCTCCAGGAAGGCGGAAGCATAAAGAAATTAATTGTT
 
. : . : . : . : . : . :
JMSF052D09+ TTCTAAATTGGGAATTAGGGTTAGAATGGTGTATAGAAAGGGGGTGCAAACGAACCTGAG
JMSF051D09+ TTCTAAATTGGGAATTAGGGTTAGAATGGTGTATAGAAAGGGGGTGCAAACGAACCTGAG
                      ____________________________________________________________
consensus TTCTAAATTGGGAATTAGGGTTAGAATGGTGTATAGAAAGGGGGTGCAAACGAACCTGAG
 
. : . : . : . : . : . :
JMSF052D09+ GGTGAAGACTGAAGACGGAGCCCAGCCGGCGACAGTTGAAGACGAAGCCGAGCGAAGTGG
JMSF051D09+ GGTGAAGACTGAAGACGGAGCCCAGCCGGCGACAGTTGAAGACGAAGCCGAGCGAAGTGG
                      ____________________________________________________________
consensus GGTGAAGACTGAAGACGGAGCCCAGCCGGCGACAGTTGAAGACGAAGCCGAGCGAAGTGG
 
. : . : . : . : . : . :
JMSF052D09+ CGAGACGCAGAGGAAGCGGTGGTTCACGACTCGCGAGATAGAGCGACAAAGTCTATTTTC
JMSF051D09+ CGAGACGCAGAGGAAGCGGTGGTTCACGACTCGCGAGATAGAGCGACAAAGTCTATTTTC
                      ____________________________________________________________
consensus CGAGACGCAGAGGAAGCGGTGGTTCACGACTCGCGAGATAGAGCGACAAAGTCTATTTTC