Previous Contig 008036:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF051B24Sequence644008036 (2)gb:AF325013_17864673e-15Arabidopsis thaliana At1g17620 (At1g17620/F11A6_23) mRNA, complete cds.509008036 (2)gb:AF325013_17864676e-15Arabidopsis thaliana At1g17620 (At1g17620/F11A6_23) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051B24- GGTCTCACAGAGAGAGAAAGAGAGAGAGAGAGAGAGAGAGAGAG
                      ____________________________________________________________
consensus GGTCTCACAGAGAGAGAAAGAGAGAGAGAGAGAGAGAGAGAGAG
 
. : . : . : . : . : . :
JMSF051B24- GATCTAATTCCATACAAATAACTTATAGCTGCAGTTATGGCTGATAAAAGTGACAAGATC
                      ____________________________________________________________
consensus GATCTAATTCCATACAAATAACTTATAGCTGCAGTTATGGCTGATAAAAGTGACAAGATC
 
. : . : . : . : . : . :
rJMSF051B24+ TCGCCGCCGCCACCAACGGCGGCGNTAAGTCACAG
JMSF051B24- AACCCAACAGCCAAGCTTCCCCCCGTCGCCGCCGCCACCAACGGCGGCGCTAAGTCACAG
                      ____________________________________________________________
consensus AACCCAACAGCCAAGCTTCCCCCCGTCGCCGCCGCCACCAACGGCGGCGCTAAGTCACAG
 
. : . : . : . : . : . :
rJMSF051B24+ ACTTACAATGCCCCTCGCCCCATGTACCGCCCCAAACCGCCGTCTCGCCGCCGCGGCAGC
JMSF051B24- ACTTACAATGCCCCTCGCCCCATGTACCGCCCCAAACCGCCGTCTCGCCGCCGCGGCAGC
                      ____________________________________________________________
consensus ACTTACAATGCCCCTCGCCCCATGTACCGCCCCAAACCGCCGTCTCGCCGCCGCGGCAGC
 
. : . : . : . : . : . :
rJMSF051B24+ CGCAGCTGCGTCTGTTGCTGCTGTCTCTGGATCACCTTCCTCGTCATTATTCTCGTCCTC
JMSF051B24- CGCAGCTGCGTCTGTTGCTGCTGTCTCTGGATCACCTTCCTCGTCATTATTCTCGTCCTC
                      ____________________________________________________________
consensus CGCAGCTGCGTCTGTTGCTGCTGTCTCTGGATCACCTTCCTCGTCATTATTCTCGTCCTC
 
. : . : . : . : . : . :
rJMSF051B24+ CTTGTCGCCGGCGCCGGCGCCATTTTCTGGCTGATCTACCGCCCCCAGCGCCCCGATTTC
JMSF051B24- CTTGTCGCCGGCGCCGGCGCCATTTTCTGGNTGATCTACCGCCCCCAGCGCCCCGATTTC
                      ____________________________________________________________
consensus CTTGTCGCCGGCGCCGGCGCCATTTTCTGGCTGATCTACCGCCCCCAGCGCCCCGATTTC
 
. : . : . : . : . : . :
rJMSF051B24+ GTGGTCGACTCCCTCCAGCTCTCCCAGCTCGCCCTAACCTCCTCCGCGCTCACCTCCAAG
JMSF051B24- GTGGTCGACTCCCTCCAGCTCTCCCAGCTCGCCCTAACCTCCTCCGCGCTCACCTCCAAG
                      ____________________________________________________________
consensus GTGGTCGACTCCCTCCAGCTCTCCCAGCTCGCCCTAACCTCCTCCGCGCTCACCTCCAAG
 
. : . : . : . : . : . :
rJMSF051B24+ TTCACCGTCTCCCTCTCCGCCCGCAACCCTAACAAGAAGGTCGAGTTCATCTACGATCCA
JMSF051B24- TTCACCGTCTCCCTCTCCGCCCGCAACCCTAACAAGAAGGTCGAGTTCATCTACGATCCA
                      ____________________________________________________________
consensus TTCACCGTCTCCCTCTCCGCCCGCAACCCTAACAAGAAGGTCGAGTTCATCTACGATCCA
 
. : . : . : . : . : . :
rJMSF051B24+ ATTTCCGTCTCCGTGTTCTCCGGCGACGCCGCCATCGGATCCGGAACGATACCTGGATTC
JMSF051B24- ATTTCCGTCTCCGTGTTCTCCGGCGACGCCGCCATCGGATCCGGAACGATACCTGGATTC
                      ____________________________________________________________
consensus ATTTCCGTCTCCGTGTTCTCCGGCGACGCCGCCATCGGATCCGGAACGATACCTGGATTC
 
. : . : . : . : . : . :
rJMSF051B24+ GAACACGGCGCCAAGAACACTACCGCGCTGAAAACTAACGTTGCGGCTGCCGGGGAGAGT
JMSF051B24- GAACACGGCGCCAAGAACACTACCGCGCTGAAAACTAACGTTGCGGCTGCCGGGGAGAGT
                      ____________________________________________________________
consensus GAACACGGCGCCAAGAACACTACCGCGCTGAAAACTAACGTTGCGGCTGCCGGGGAGAGT
 
. : . : . : . : . : . :
rJMSF051B24+ CTCGACGCCGATCAGGTTTCGGCGATGAAATCGGCGATCAAAAACAAGAGCCGT
JMSF051B24- CTCGACGCCGATCAGGTTTCGGCGATGAAATCGGCGATCAAAAACAAGAGCCGTTTCCCG
                      ____________________________________________________________
consensus CTCGACGCCGATCAGGTTTCGGCGATGAAATCGGCGATCAAAAACAAGAGCCGTTTCCCG